ID: 1058412147

View in Genome Browser
Species Human (GRCh38)
Location 9:104745979-104746001
Sequence CTGAGGCTGAGGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058412147_1058412153 -7 Left 1058412147 9:104745979-104746001 CCTTCTTCCCTCCTCAGCCTCAG No data
Right 1058412153 9:104745995-104746017 GCCTCAGGAAACTGGCAGCAAGG No data
1058412147_1058412155 19 Left 1058412147 9:104745979-104746001 CCTTCTTCCCTCCTCAGCCTCAG No data
Right 1058412155 9:104746021-104746043 TTCTCACACAGATAAGATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058412147 Original CRISPR CTGAGGCTGAGGAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr