ID: 1058412371

View in Genome Browser
Species Human (GRCh38)
Location 9:104747874-104747896
Sequence AAGCCTTCACCCGACGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 36}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058412355_1058412371 21 Left 1058412355 9:104747830-104747852 CCTCACGGACGCTGGCGCCTCAG 0: 1
1: 1
2: 0
3: 7
4: 73
Right 1058412371 9:104747874-104747896 AAGCCTTCACCCGACGGGAGGGG 0: 1
1: 0
2: 0
3: 0
4: 36
1058412363_1058412371 -5 Left 1058412363 9:104747856-104747878 CCGGCCACGGGGGTACCCAAGCC 0: 1
1: 0
2: 2
3: 5
4: 93
Right 1058412371 9:104747874-104747896 AAGCCTTCACCCGACGGGAGGGG 0: 1
1: 0
2: 0
3: 0
4: 36
1058412364_1058412371 -9 Left 1058412364 9:104747860-104747882 CCACGGGGGTACCCAAGCCTTCA 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1058412371 9:104747874-104747896 AAGCCTTCACCCGACGGGAGGGG 0: 1
1: 0
2: 0
3: 0
4: 36
1058412362_1058412371 4 Left 1058412362 9:104747847-104747869 CCTCAGGTACCGGCCACGGGGGT 0: 1
1: 0
2: 0
3: 9
4: 67
Right 1058412371 9:104747874-104747896 AAGCCTTCACCCGACGGGAGGGG 0: 1
1: 0
2: 0
3: 0
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058412371 Original CRISPR AAGCCTTCACCCGACGGGAG GGG Intronic