ID: 1058413776

View in Genome Browser
Species Human (GRCh38)
Location 9:104764091-104764113
Sequence GGTCAGCTCCACCCCGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 2, 1: 0, 2: 0, 3: 8, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058413776_1058413786 13 Left 1058413776 9:104764091-104764113 CCCGCGCCGGGGTGGAGCTGACC 0: 2
1: 0
2: 0
3: 8
4: 111
Right 1058413786 9:104764127-104764149 CCCCTGCCTGAGTTCGCCAGTGG 0: 1
1: 0
2: 1
3: 9
4: 132
1058413776_1058413790 19 Left 1058413776 9:104764091-104764113 CCCGCGCCGGGGTGGAGCTGACC 0: 2
1: 0
2: 0
3: 8
4: 111
Right 1058413790 9:104764133-104764155 CCTGAGTTCGCCAGTGGTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058413776 Original CRISPR GGTCAGCTCCACCCCGGCGC GGG (reversed) Intergenic
900288994 1:1915894-1915916 GGGCTGCTCCACCCTGGCCCCGG - Intronic
900403816 1:2483802-2483824 GGTCAGCGCCACCCCCACACGGG - Intronic
900403825 1:2483825-2483847 GGTCAGCGCCACCCCCACACGGG - Intronic
903172183 1:21561138-21561160 GGTCAGCTCCACCACAACCCTGG + Exonic
904302123 1:29561234-29561256 GCTCAGCTTCACCCCAGGGCTGG + Intergenic
904455166 1:30643057-30643079 GCTCAGCTTCACCCCAGGGCTGG - Intergenic
904652592 1:32016815-32016837 TGTCAGCTCCACCAGAGCGCAGG + Intronic
906069635 1:43007573-43007595 GGGCAGCCCCGCCCCGCCGCCGG + Intergenic
915339198 1:155167074-155167096 GCTCAGTTCCACCCCGGAGGAGG - Intergenic
919728114 1:200896827-200896849 GGTGAGCTCCACCCCTCCTCAGG - Intronic
920389865 1:205592671-205592693 GGTCAGAACCACCCCGGCTGTGG - Intronic
924825148 1:247531115-247531137 GCTCAGCTCACCCCAGGCGCAGG + Exonic
1064028818 10:11870022-11870044 GGGCGGCTCCTCCCCGGAGCGGG + Exonic
1069577527 10:69541478-69541500 GGGCAGCTCCACCCCTGTGGAGG + Intergenic
1075054329 10:119206916-119206938 GGTCGGCTGCGACCCGGCGCTGG - Intergenic
1077549657 11:3194463-3194485 GGGCAGCTCCACCCCAGCCCCGG + Intergenic
1079028367 11:16966791-16966813 AGTCAGCCCCACCCCTGCTCTGG + Intronic
1080836368 11:35944280-35944302 GGTCCGGGCCAGCCCGGCGCCGG - Intronic
1084483337 11:69434517-69434539 GCCCAGCCCCACCCCGGCCCAGG + Intergenic
1085045890 11:73353166-73353188 GTTCAGGTCCACCCAGGGGCTGG - Intronic
1092144504 12:6205153-6205175 AGCCAGCTTCACCCCAGCGCAGG - Intronic
1092759609 12:11797675-11797697 GTTCAGCTCCACCCAGACTCCGG - Intronic
1105900535 13:24748025-24748047 TGTCAGGTCCAGCCCGGAGCGGG - Intergenic
1112752384 13:102596531-102596553 GGTCAGCAGCACCCCGGGGCTGG + Intergenic
1113772030 13:112916585-112916607 GTTGAGCTCCACCCCTGCACTGG + Intronic
1113904858 13:113814564-113814586 GGGCAGCTCCCACCTGGCGCAGG + Exonic
1113940879 13:114018106-114018128 GGTCCGCTTCACCTCCGCGCTGG + Exonic
1120931008 14:89848497-89848519 AGTCAGCTCCAGCACGGCACTGG + Intronic
1121525934 14:94619330-94619352 CTTCAGCTCCACCACGGTGCAGG - Exonic
1121526062 14:94620376-94620398 CTTCAGCTCCACCACGGTGCAGG + Intronic
1122577416 14:102751009-102751031 GGTCAGTTCCACCCCTGGGCTGG + Intergenic
1122767247 14:104081124-104081146 GGTCACCTCCACCCTGAGGCTGG - Intergenic
1122775917 14:104116934-104116956 AGTCAGGGCCACCCCCGCGCGGG + Intergenic
1124342781 15:28900924-28900946 GGTCAGCCCCAGCCAGGGGCAGG - Intronic
1126165454 15:45650967-45650989 GGGCAGCTCCGCCTCGGCTCTGG - Intronic
1129941173 15:79497744-79497766 GGGCAGCCCCACCCCGGGACAGG - Intergenic
1131558547 15:93419859-93419881 TGCCAGCTCCACCCGGGAGCAGG + Intergenic
1132118436 15:99156192-99156214 GGTCTGCTCCTCCCAGGAGCCGG + Exonic
1132483883 16:180476-180498 GGACAGCGCCATCCCCGCGCTGG - Exonic
1132549893 16:550005-550027 GGCCAGCTCCAGCCCCGCCCAGG - Intronic
1133238733 16:4402576-4402598 GGACAGCGCCACCCCTGGGCAGG + Intronic
1139700883 16:68707386-68707408 ACTCAGCTCCATCCCGGGGCTGG + Intronic
1143778817 17:9218646-9218668 GGTAAGCCCCACCCCGGGGGTGG - Intronic
1145261633 17:21358007-21358029 GGTCAGCTGCAGCCCTGCCCAGG - Intergenic
1149992885 17:61392592-61392614 GGTCAGCCCCACTCCAGCACGGG + Exonic
1151493331 17:74445299-74445321 AGTCAGCTCCATCCCAGCTCTGG - Intronic
1152224977 17:79088632-79088654 GGGCAGCACCAGCCCGGCCCTGG + Intergenic
1159251822 18:65889345-65889367 GGACAGCTCCAACCCAGTGCTGG + Exonic
1160024097 18:75204702-75204724 TCTCAACTCCACCGCGGCGCCGG - Intronic
1160764704 19:802298-802320 GTTCAGCTCCACTCCTGCCCTGG - Intronic
1161101868 19:2425493-2425515 GGTGAGCCCCGCCCCGGCCCAGG + Exonic
1163760666 19:19134762-19134784 GGTGAGCCCCGCCCCGGCGGTGG - Exonic
1163819610 19:19488470-19488492 GGACAGCTCCTTCCCGGCACTGG + Intronic
1165098132 19:33421395-33421417 GGTCAGCCCAGCCCCTGCGCTGG - Intronic
1167015483 19:46838419-46838441 GGCGAGCCCCACCCCGGCCCCGG - Exonic
925905013 2:8535126-8535148 GGACAGCCCCACCCCAGCCCAGG + Intergenic
927751254 2:25673064-25673086 GGGCAGCATCAGCCCGGCGCCGG + Intronic
937915047 2:127094851-127094873 GGGCAGCACCACCCGGGGGCTGG - Intronic
942449626 2:176100773-176100795 GGGCAGATCCAACCCGGCCCTGG - Exonic
945470684 2:210225042-210225064 GGCCAGCTCTAGCCCGGCGCCGG + Intronic
947592604 2:231394153-231394175 GGTCAGCCCCTCCCCTGCTCTGG + Intergenic
947765305 2:232633850-232633872 GCTCAGCTCCGCGTCGGCGCTGG - Exonic
1168931949 20:1631001-1631023 GGCCACCTCCACCCCAGTGCAGG + Intronic
1169818219 20:9680746-9680768 GGTCTGCTCCAGACCGGAGCAGG + Intronic
1172891776 20:38271007-38271029 GGTCTCCTCCACCCAGGCACTGG - Intronic
1175503958 20:59469096-59469118 GGTCAGCTGCACCCTGGAGGGGG + Intergenic
1176548045 21:8209870-8209892 GGTCAGCCCCTCTCCGGCCCCGG + Intergenic
1176555938 21:8254080-8254102 GGTCAGCCCCTCTCCGGCCCCGG + Intergenic
1176566976 21:8392905-8392927 GGTCAGCCCCTCTCCGGCCCCGG + Intergenic
1176574875 21:8437115-8437137 GGTCAGCCCCTCTCCGGCCCCGG + Intergenic
1176611490 21:8988411-8988433 GGTCAGCCCCTCTCCGGCCCCGG + Intergenic
1179908701 21:44436986-44437008 GGCCAGCCCCGCCGCGGCGCAGG + Intronic
1180797109 22:18611365-18611387 GGGCTGCTCCAGCCCGGCGGCGG - Exonic
1181224614 22:21383906-21383928 GGGCTGCTCCAGCCCGGCGGCGG + Exonic
1181254018 22:21550907-21550929 GGGCTGCTCCAGCCCGGCGGCGG - Exonic
1184118643 22:42436510-42436532 GGTCAGCACCACCCAGCTGCAGG - Intergenic
1203252924 22_KI270733v1_random:126170-126192 GGTCAGCCCCTCTCCGGCCCCGG + Intergenic
1203260979 22_KI270733v1_random:171251-171273 GGTCAGCCCCTCTCCGGCCCCGG + Intergenic
950072604 3:10164785-10164807 CGCCGGCTCCACCCCAGCGCCGG - Intergenic
950168126 3:10816604-10816626 GTTCCGCTCCACGCAGGCGCGGG - Intronic
953549935 3:43894333-43894355 TGCCCGCTCCGCCCCGGCGCAGG + Intergenic
957792628 3:84959668-84959690 GGTAATCCCCGCCCCGGCGCAGG + Intronic
968307917 3:197661719-197661741 GCTCAGCTGCACCCCTGAGCTGG - Intergenic
973705435 4:53575928-53575950 GGTCAGCACCAACCTGCCGCAGG + Intronic
984832394 4:183987685-183987707 GGTGAGCTCCACCGCTGCCCGGG + Intronic
991191897 5:63884422-63884444 GGTCACCTCCACCCCATCTCTGG + Intergenic
992529183 5:77638880-77638902 TGGCAGCTCCAGCCCGGAGCAGG + Exonic
992663710 5:78985329-78985351 GGCCTGCTCCGCCCCGGCGCGGG + Exonic
994768546 5:103953728-103953750 GGGCAGCTCCACCAAGGCCCAGG - Intergenic
999314247 5:150574049-150574071 TTTCAGCTCCTCCGCGGCGCTGG - Intergenic
1002136865 5:177113011-177113033 GGTGTGCTCCACACCGGCCCTGG + Intergenic
1003139283 6:3457150-3457172 GGTTACCTCCACCTCGGCGGGGG - Intergenic
1006189505 6:32198958-32198980 AGTCAGCTCCCCACCGACGCCGG - Exonic
1007093580 6:39199763-39199785 GCTCAGCTCCACCCAAGTGCTGG + Intronic
1009952525 6:70413600-70413622 GGTCAGCACCATCCCGCCCCGGG - Exonic
1012996674 6:105981858-105981880 GGACAGCTCCACTACGGCGAGGG + Intergenic
1016982115 6:149863577-149863599 GGGCAGCTCCACCACGGCCACGG + Exonic
1018070662 6:160161640-160161662 GGTCTCCTCCACCCTGGAGCAGG + Intergenic
1023477158 7:40593178-40593200 GTTCAGCTCCTCCCCTGCTCTGG - Intronic
1025255970 7:57384145-57384167 GGTCAGGTCAAGCCCGGAGCTGG + Intergenic
1029126975 7:98301241-98301263 CGTCACCTCCACCCCTGTGCTGG + Intronic
1031401337 7:121329048-121329070 GCACATCTCCACCCCTGCGCAGG + Exonic
1033159072 7:138981198-138981220 GGCCAGCGCGACCCCGGCGCGGG + Exonic
1036236433 8:7043227-7043249 GGTCAGCTCCAACCTAGCGCAGG - Intergenic
1039733492 8:40305306-40305328 GTTCAGCAGCACCCAGGCGCAGG + Intergenic
1040355950 8:46618221-46618243 GGTGAGCTCCACTCCAGCGAGGG + Intergenic
1043148224 8:76682072-76682094 TGTCAGCTCCGCAACGGCGCGGG + Intronic
1045036479 8:98180256-98180278 GGCCAGCACCACCCCAGCTCAGG - Intergenic
1049265907 8:141667804-141667826 GCTGAGCTCCACCCAGGCCCTGG - Intergenic
1056381012 9:86057506-86057528 CCTCAGCTGCACCCCGGCTCGGG - Intronic
1058412317 9:104747643-104747665 GGTCAGCTCCACCCCGGCGCGGG - Intergenic
1058413776 9:104764091-104764113 GGTCAGCTCCACCCCGGCGCGGG - Intergenic
1060759114 9:126233768-126233790 GCTCAGCCCCATCCCGGCTCTGG - Intergenic
1061429780 9:130523762-130523784 GGTCAGCTGCTCCCAGGAGCGGG - Intergenic
1062334831 9:136060522-136060544 GGTCAGCTCCACACTGGGGCCGG + Intronic
1203469326 Un_GL000220v1:109317-109339 GGTCAGCCCCTCTCCGGCCCCGG + Intergenic
1203477147 Un_GL000220v1:153289-153311 GGTCAGCCCCTCTCCGGCCCCGG + Intergenic
1185432973 X:19975-19997 GGTCGGCTCCCGCCCGGGGCTGG - Intergenic
1186509285 X:10118309-10118331 GTTCAGCTCCTCCTCGGAGCTGG + Intronic
1192506249 X:71685380-71685402 CTTCAGCTCCACCCCAGTGCCGG - Intergenic
1192520448 X:71796168-71796190 CTTCAGCTCCACCCCAGTGCCGG + Intergenic