ID: 1058417307

View in Genome Browser
Species Human (GRCh38)
Location 9:104802441-104802463
Sequence CACACGAGCCACTGGGTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 125}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058417307_1058417321 23 Left 1058417307 9:104802441-104802463 CCTCCAACCCAGTGGCTCGTGTG 0: 1
1: 0
2: 0
3: 4
4: 125
Right 1058417321 9:104802487-104802509 AGATGGGGAGTTGGGAGAGTGGG No data
1058417307_1058417314 -5 Left 1058417307 9:104802441-104802463 CCTCCAACCCAGTGGCTCGTGTG 0: 1
1: 0
2: 0
3: 4
4: 125
Right 1058417314 9:104802459-104802481 GTGTGTGAATGTGGGTCTGGAGG No data
1058417307_1058417319 15 Left 1058417307 9:104802441-104802463 CCTCCAACCCAGTGGCTCGTGTG 0: 1
1: 0
2: 0
3: 4
4: 125
Right 1058417319 9:104802479-104802501 AGGCAAGCAGATGGGGAGTTGGG No data
1058417307_1058417316 7 Left 1058417307 9:104802441-104802463 CCTCCAACCCAGTGGCTCGTGTG 0: 1
1: 0
2: 0
3: 4
4: 125
Right 1058417316 9:104802471-104802493 GGGTCTGGAGGCAAGCAGATGGG No data
1058417307_1058417318 14 Left 1058417307 9:104802441-104802463 CCTCCAACCCAGTGGCTCGTGTG 0: 1
1: 0
2: 0
3: 4
4: 125
Right 1058417318 9:104802478-104802500 GAGGCAAGCAGATGGGGAGTTGG No data
1058417307_1058417315 6 Left 1058417307 9:104802441-104802463 CCTCCAACCCAGTGGCTCGTGTG 0: 1
1: 0
2: 0
3: 4
4: 125
Right 1058417315 9:104802470-104802492 TGGGTCTGGAGGCAAGCAGATGG No data
1058417307_1058417317 8 Left 1058417307 9:104802441-104802463 CCTCCAACCCAGTGGCTCGTGTG 0: 1
1: 0
2: 0
3: 4
4: 125
Right 1058417317 9:104802472-104802494 GGTCTGGAGGCAAGCAGATGGGG No data
1058417307_1058417313 -8 Left 1058417307 9:104802441-104802463 CCTCCAACCCAGTGGCTCGTGTG 0: 1
1: 0
2: 0
3: 4
4: 125
Right 1058417313 9:104802456-104802478 CTCGTGTGTGAATGTGGGTCTGG No data
1058417307_1058417320 22 Left 1058417307 9:104802441-104802463 CCTCCAACCCAGTGGCTCGTGTG 0: 1
1: 0
2: 0
3: 4
4: 125
Right 1058417320 9:104802486-104802508 CAGATGGGGAGTTGGGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058417307 Original CRISPR CACACGAGCCACTGGGTTGG AGG (reversed) Intronic
900679408 1:3908109-3908131 CACACGTGTCTCTGGGTTTGTGG + Intergenic
904051693 1:27643672-27643694 CACTAGAGCCACTGAGTGGGAGG - Intergenic
905826182 1:41027669-41027691 CACACTAGACACTGGGTTTCAGG - Exonic
905845265 1:41225208-41225230 CACACGAGAACCTGGGTAGGAGG + Intronic
907457190 1:54583229-54583251 CCCAAGAGCCCCTGGGTAGGAGG - Intronic
910160419 1:84266529-84266551 TACACGACTCACTGGGTTAGTGG + Intergenic
912670627 1:111620453-111620475 CACACGGGGAACGGGGTTGGAGG + Intronic
915363635 1:155301189-155301211 CACATCAGCCACTGGCTAGGTGG - Intronic
917271202 1:173276534-173276556 GAAAGGAGCCACTGAGTTGGAGG + Intergenic
924083635 1:240425458-240425480 CACAAAAGCAACTGGGGTGGGGG - Intronic
1063116142 10:3073370-3073392 CACACGGGCCCTGGGGTTGGGGG - Intronic
1063953895 10:11248143-11248165 CACAGGAGCCACGGGGTGGAAGG - Intronic
1065335142 10:24649458-24649480 CAAAGTAGCCTCTGGGTTGGTGG - Intronic
1067743466 10:48914535-48914557 CACACATGGCTCTGGGTTGGGGG - Intronic
1071522928 10:86342049-86342071 CACACCAGCCCCTCAGTTGGAGG - Intronic
1075701028 10:124469493-124469515 CACACCAGCCCCTGAGGTGGGGG + Intronic
1076557292 10:131335510-131335532 CAGATGTGCCACTGGCTTGGGGG - Intergenic
1077191068 11:1256113-1256135 CAGACAAGCCAAGGGGTTGGGGG - Intronic
1077464470 11:2727015-2727037 CACTTAAGCCACTTGGTTGGGGG + Intronic
1081489353 11:43555427-43555449 CACATGAGACACATGGTTGGGGG + Intergenic
1085034004 11:73289399-73289421 CACAGGAGCCACTGGGGACGTGG - Intronic
1085765817 11:79280640-79280662 TACAGGAGCCACAGGCTTGGAGG - Intronic
1086402852 11:86474554-86474576 CAAGCCAGCCAGTGGGTTGGTGG - Intronic
1086925244 11:92632915-92632937 CACATGAGCCACTTTGTTAGGGG - Intronic
1088089602 11:106022293-106022315 CATATGAGCCATTGGGGTGGCGG - Intronic
1089631544 11:119787467-119787489 CCCACCAGCCACTGGGGTAGGGG + Intergenic
1090220195 11:125014085-125014107 TTCAGGACCCACTGGGTTGGGGG + Intronic
1100620870 12:96271455-96271477 CACACGCGCCACTGGGGAGTGGG - Intergenic
1103517511 12:121517021-121517043 CACTAGAGCCACTGGGAGGGGGG + Intronic
1106469756 13:30043826-30043848 CTCAGGAGCCACTGAGTTAGAGG + Intergenic
1107725423 13:43294111-43294133 CACATGGGCCACTGGCTTGCTGG + Intronic
1109744955 13:66613074-66613096 CCCAGGAGCGACTGGGGTGGAGG - Intronic
1116027618 14:39534399-39534421 CTCTAGCGCCACTGGGTTGGGGG - Intergenic
1122827280 14:104376412-104376434 CACGAGAGCCAGAGGGTTGGGGG - Intergenic
1127973941 15:63983498-63983520 CCCAGGACCCACAGGGTTGGGGG - Intronic
1136632472 16:31496940-31496962 CTCACGATGCACTGGGTGGGAGG + Exonic
1138331453 16:56219042-56219064 CAGAAGAGCAGCTGGGTTGGGGG - Intronic
1147721351 17:42541462-42541484 CAAACGAGACACTGGGAAGGAGG - Intronic
1147987475 17:44314900-44314922 CAGAGGAGCCACAGGGTTGGAGG - Intronic
1150681802 17:67290702-67290724 CTGAGGGGCCACTGGGTTGGTGG - Intergenic
1151619624 17:75237930-75237952 CACTGAAGCCACTGGGGTGGGGG - Exonic
1151805142 17:76400400-76400422 CACGCGTGCCCCTGGGTTGCTGG + Intronic
1152481308 17:80555417-80555439 CACAAGAGCTACTGGGTGGGCGG - Intronic
1152566369 17:81102158-81102180 GAGACGAGCCTCTGGGCTGGGGG + Intronic
1153836790 18:8970679-8970701 CAGAAGAGCCACTGGGCTCGTGG + Intergenic
1154415815 18:14174708-14174730 CACGCCAGCCACTGGGTGGCAGG + Intergenic
1157564123 18:48668284-48668306 CACAGGAGACACTGGGGAGGTGG + Intronic
1160628967 18:80232221-80232243 CACACCAGGGACTGGGTGGGTGG + Intronic
1160954996 19:1687053-1687075 CACACCAACCCCTGGGCTGGGGG + Intergenic
1161980088 19:7625846-7625868 CACACGGGGCTCTGGGTTCGGGG - Intronic
1163312133 19:16521085-16521107 CAGAGGAGCCACTGGGCTGCAGG - Exonic
1165955713 19:39500714-39500736 CACGTGAGACACGGGGTTGGTGG + Intronic
1166192888 19:41187230-41187252 AACAGGAGACACTGGGTTGCAGG + Intergenic
926696380 2:15772264-15772286 CCCACCAGCCACTGGCTCGGTGG - Intergenic
931675548 2:64692547-64692569 CACACGTGGCTCTTGGTTGGAGG + Intronic
934768961 2:96895873-96895895 CACAAGAGCAGCTGGGCTGGGGG + Intronic
935173628 2:100629421-100629443 CTCCCAAGGCACTGGGTTGGAGG - Intergenic
943023621 2:182602863-182602885 CAGAAGAGACACTGGGTTAGAGG + Intergenic
943042824 2:182823561-182823583 GACTTGAGCCACTGGGTTGATGG - Intergenic
948211299 2:236195215-236195237 CACACAAGCCCCTGGGGTAGAGG - Intronic
948218837 2:236253149-236253171 CTCACGAGCCACTGGGAGGATGG + Intronic
1168894438 20:1313550-1313572 CTCAGGAGACACTGGGGTGGGGG + Intronic
1169758214 20:9065746-9065768 CACTTGAGCCCCTGGGTTTGAGG + Intergenic
1170871963 20:20214251-20214273 AACACAATCCACTGGGATGGTGG - Intronic
1171158608 20:22899975-22899997 CCCACTAGCCACTGAGTTGAGGG + Intergenic
1171977942 20:31607170-31607192 CGCAGGAGCCCCGGGGTTGGTGG - Intergenic
1175754730 20:61522280-61522302 CACCCGCTCCACTGGCTTGGGGG - Intronic
1178263823 21:31124341-31124363 CCCAGGAGCCACTGGGAAGGAGG + Intronic
1181026695 22:20131353-20131375 CCCTCGGGCCACTGGGCTGGAGG - Intronic
1181386802 22:22552001-22552023 GACATGAGCCACTGTGCTGGAGG - Intronic
1181454877 22:23053430-23053452 CACAGGAGACACTGGCATGGAGG + Intergenic
1184021064 22:41821832-41821854 CACAGAAGCAAATGGGTTGGTGG + Intronic
1184668438 22:46000693-46000715 CTTCAGAGCCACTGGGTTGGGGG - Intergenic
1184671522 22:46014283-46014305 CACTCGAGACACAGGGTGGGCGG - Intergenic
950023883 3:9807871-9807893 CAGCCCAGCCACTGGGCTGGTGG - Intronic
951763815 3:26174397-26174419 CACACAAGCCACAGAGTGGGAGG - Intergenic
953551796 3:43908849-43908871 CACACCAGCCACAGGTGTGGGGG + Intergenic
953744244 3:45561031-45561053 CACAAGAGTCACTGGGCTTGGGG + Intronic
960634598 3:119770724-119770746 CAGAAGAGCCACTGGGTTTTTGG - Intergenic
961516849 3:127443448-127443470 CACACAAGTCACTGGGATTGGGG + Intergenic
963397246 3:144750089-144750111 CACAGGAGCCCCCGGGGTGGGGG - Intergenic
965537172 3:169835478-169835500 CACAGGGGCAACTGGGATGGGGG + Intronic
967769822 3:193322234-193322256 CACACTTGGCTCTGGGTTGGAGG - Intronic
967917657 3:194590702-194590724 CACCCTAGCCCCTGGGTAGGGGG + Intronic
969636576 4:8372951-8372973 CACGGCAGCCGCTGGGTTGGGGG - Intronic
980844652 4:138309686-138309708 CAGAGGAGCCCCTGGGTGGGAGG + Intergenic
984236081 4:177160196-177160218 CACACATGCCACTGGGGTAGGGG - Intergenic
988663944 5:33304392-33304414 CACACAAGCTTCAGGGTTGGGGG - Intergenic
989818098 5:45761280-45761302 CACAGGAGATACTTGGTTGGTGG + Intergenic
990928636 5:61060595-61060617 GACACGAGCTCCTGGGTTGGAGG - Intronic
992253766 5:74901221-74901243 CACTTAAGCCACTGGGTTTGTGG - Intergenic
998741815 5:145211929-145211951 CACAGCAGACACTTGGTTGGTGG - Intergenic
999777407 5:154822172-154822194 CACATGAGCCCAGGGGTTGGAGG + Intronic
1000345960 5:160313359-160313381 CACACGAGGCTCTGAGTTTGAGG - Intronic
1000505040 5:162106068-162106090 CACACGAGACATTGGGGAGGTGG - Intronic
1002188987 5:177469174-177469196 CACCCGCTCCACTGGGTTGTAGG - Intronic
1008587493 6:52962712-52962734 CACAGGAGCCCATGGGGTGGGGG + Intergenic
1017462324 6:154663040-154663062 TACAAGAGCCCTTGGGTTGGAGG - Intergenic
1017686918 6:156922922-156922944 CACACGAGCCACAGACCTGGAGG - Intronic
1018195062 6:161348277-161348299 GACACGAGCCACTGGGTGCAGGG + Exonic
1018544048 6:164916069-164916091 CACATGAGGCCCAGGGTTGGAGG - Intergenic
1019391227 7:787702-787724 CTCAAGAGCCCCTGGGTCGGTGG + Intergenic
1019478826 7:1256812-1256834 CAGAAGGGCCAATGGGTTGGTGG + Intergenic
1019576540 7:1740306-1740328 CATACGAGCCTCTGGGTCTGAGG + Intronic
1019819676 7:3233251-3233273 CACAAAAGCAAGTGGGTTGGGGG - Intergenic
1021451969 7:20791121-20791143 CACACTAGTCAAGGGGTTGGGGG - Intergenic
1026548922 7:71350306-71350328 CACACCAGGCACTATGTTGGAGG + Intronic
1027868331 7:83674895-83674917 AACACTAGTCACTGGGTTGCAGG - Intergenic
1030097082 7:105909974-105909996 CACGTGACCCACTGGCTTGGAGG + Intronic
1030579120 7:111330488-111330510 CCCACTAGCCACGGGGTGGGGGG + Intronic
1038346900 8:26741261-26741283 ACCATGTGCCACTGGGTTGGGGG + Intergenic
1041138400 8:54786901-54786923 CTCAAGAGCCACTTGGATGGTGG - Intergenic
1041192568 8:55368384-55368406 CACACGAGCCAGTGGGAGAGTGG - Intronic
1047306442 8:123656778-123656800 CACTCGAGCCTCGGAGTTGGAGG - Intergenic
1047828492 8:128605392-128605414 CACAAGAGCCTCTGGGATGGGGG + Intergenic
1049157935 8:141078327-141078349 GACCCCAGCCACTGGGTTTGGGG + Intergenic
1050923375 9:11233987-11234009 AAAAGGAGCCACTGGGCTGGAGG + Intergenic
1053293024 9:36894505-36894527 GACAAGAGCCACAGGGCTGGTGG + Intronic
1053297466 9:36925076-36925098 CAAAGGAGCCACTGGGTGGCAGG + Intronic
1054754096 9:68939638-68939660 CAGACGACACACTGGGGTGGTGG - Intronic
1057443432 9:95097973-95097995 CACCCGAGCCCCCGGGCTGGGGG + Intergenic
1058417307 9:104802441-104802463 CACACGAGCCACTGGGTTGGAGG - Intronic
1058854148 9:109043688-109043710 CACACCAGCCACTGAGCTAGAGG + Intronic
1060649769 9:125315425-125315447 CAAAGCAGCCACTGGGCTGGGGG - Intronic
1061866427 9:133493890-133493912 CATACCAGGCACTGGGATGGGGG + Intergenic
1062707810 9:137954840-137954862 CACACAAGCTTCTGAGTTGGTGG - Intronic
1186464650 X:9775496-9775518 CAGAGGAGCCACAGGGGTGGAGG - Intronic
1189216083 X:39325299-39325321 CTCACAATCCACTGGGTTAGTGG - Intergenic
1194606203 X:95981744-95981766 CAGACAACCCACAGGGTTGGAGG - Intergenic
1200896047 Y:8377217-8377239 CACAATAGCCACTTGGTTGCTGG + Intergenic