ID: 1058418802

View in Genome Browser
Species Human (GRCh38)
Location 9:104816055-104816077
Sequence GATAATCCTGCTCCCAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058418800_1058418802 3 Left 1058418800 9:104816029-104816051 CCTAAAAACTCAATGACTAACTC 0: 1
1: 0
2: 2
3: 8
4: 210
Right 1058418802 9:104816055-104816077 GATAATCCTGCTCCCAATGCAGG 0: 1
1: 0
2: 0
3: 4
4: 130
1058418799_1058418802 27 Left 1058418799 9:104816005-104816027 CCAACATTAATCAGATGTCGATG 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1058418802 9:104816055-104816077 GATAATCCTGCTCCCAATGCAGG 0: 1
1: 0
2: 0
3: 4
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058418802 Original CRISPR GATAATCCTGCTCCCAATGC AGG Intronic
907353142 1:53849929-53849951 GATAATGGTGCTGACAATGCTGG + Intergenic
916536493 1:165708612-165708634 GATCATCCTGACCCCAGTGCAGG - Intergenic
918053588 1:180998060-180998082 CATAATTTTCCTCCCAATGCAGG - Intronic
918844584 1:189593478-189593500 GCTATACCTGCTCCCAATGCTGG - Intergenic
920999692 1:211031402-211031424 GATCATCCTGATACCAAAGCCGG + Intronic
923037826 1:230297360-230297382 CATAATCCTGATACCAAAGCCGG - Intergenic
923529312 1:234801050-234801072 GATGATCCTCCTCCCTCTGCTGG + Intergenic
923861717 1:237898365-237898387 CTTAATGCTGCTCCCAAGGCTGG - Intergenic
1066823661 10:39532087-39532109 GATATTCCTGTTTCCAATGAAGG - Intergenic
1070392542 10:75983995-75984017 CACAATGCTGCTCCCCATGCAGG + Intronic
1070413833 10:76170565-76170587 GATAATACTGCTACCAATTTTGG + Intronic
1071381910 10:85074496-85074518 CATAATCCTGATACCAAAGCTGG - Intergenic
1072226349 10:93373540-93373562 GATAATCCAGCTTCCAGAGCTGG + Intronic
1074022651 10:109599876-109599898 GGGAATCCTTCCCCCAATGCTGG - Intergenic
1077400342 11:2352769-2352791 AGTAATCATGATCCCAATGCTGG - Intergenic
1079179221 11:18173904-18173926 GACCATCCTGCTCACAGTGCTGG + Exonic
1079277499 11:19055712-19055734 GACCATCCTGCTCACAGTGCTGG - Exonic
1082159635 11:48874900-48874922 GATATTCCCGTTTCCAATGCAGG - Intergenic
1082164008 11:48921474-48921496 GATATTCCTGTTTCCAATGAGGG + Intergenic
1082165198 11:48940847-48940869 GATAATCCGGTTTCCAATGAAGG + Intergenic
1082320670 11:50804837-50804859 GATATTCCTGTTTCCAATGAAGG - Intergenic
1084020019 11:66411745-66411767 GAGAATGGTGCTCCCCATGCTGG - Intergenic
1089305041 11:117521344-117521366 GATGACCGTGCTGCCAATGCCGG + Exonic
1098431461 12:70424306-70424328 GATAATCTTGAAACCAATGCTGG + Intronic
1098601558 12:72337307-72337329 GATAGTCATGCTCCTCATGCAGG + Intronic
1099839400 12:87946845-87946867 CATCATCCTGATACCAATGCTGG + Intergenic
1099895832 12:88645374-88645396 TATACTCCTGCTTCCAATGGAGG - Intergenic
1101372273 12:104140245-104140267 ACTAATCCTTCTCCCAATTCTGG + Intergenic
1107861337 13:44663935-44663957 GAGAATCCTGTTTCAAATGCTGG + Intergenic
1114000938 14:18244540-18244562 GATATTCCTGTTTCCAATGAAGG + Intergenic
1114001968 14:18263817-18263839 GATATTCCTGTTTCCAATGAAGG + Intergenic
1114028514 14:18553873-18553895 GAAAATACTGCTCCTAATGAAGG - Intergenic
1114141261 14:19913652-19913674 GATCATCCTGATACCAAAGCCGG + Intergenic
1114862843 14:26547206-26547228 AATAATCCTGCCCACAATTCTGG + Intronic
1131013571 15:89039388-89039410 GATCATACTGCTCCCTTTGCTGG - Intergenic
1140255628 16:73333915-73333937 GAACATCCTGCTGCCAATGCAGG + Intergenic
1143484291 17:7244561-7244583 TCTCAACCTGCTCCCAATGCTGG - Exonic
1145315603 17:21730907-21730929 GATAATCCTGGTGGCAGTGCTGG + Intergenic
1147759100 17:42786105-42786127 GATAAAACTGCCCCCTATGCAGG - Intronic
1151354119 17:73548504-73548526 GATAATCCTGATCCCATTTGTGG + Intronic
1156932689 18:42664049-42664071 CATCATCCTGCTACCAAAGCCGG + Intergenic
1158722196 18:59935435-59935457 CTTCATCCTGCTCCTAATGCTGG + Intergenic
1164343458 19:24435278-24435300 GATAATCCCGTTTCCAATGAAGG - Intergenic
1164345644 19:27252742-27252764 GATATTCCTGTTTCCAATGAAGG - Intergenic
928476043 2:31629084-31629106 GAAAACACTGCCCCCAATGCCGG + Intergenic
930426297 2:51217035-51217057 GATAATCTAGGTCCCAATTCTGG - Intergenic
931192563 2:60019418-60019440 GGGAATGCTGCTCCAAATGCTGG + Intergenic
932527927 2:72492296-72492318 GGTAAACCTGCTCCTAATGAAGG - Exonic
933519383 2:83350995-83351017 CATCATCCTGCTACCAAAGCCGG + Intergenic
934472125 2:94556993-94557015 GATATTCCTGTTTCCAATGAAGG + Intergenic
937482534 2:122277320-122277342 GATAATCCTCTTCCGAATCCAGG - Intergenic
940379630 2:152999368-152999390 CATCATCCTGATCCCAAAGCCGG + Intergenic
942194778 2:173506618-173506640 GTTAATCCTGCTGCCTTTGCTGG - Intergenic
1170374291 20:15683488-15683510 AATAATTTTGCTCCCAATACAGG - Intronic
1171514280 20:25716136-25716158 GATCATCCTGATACCAAAGCCGG - Intergenic
1171836067 20:30148475-30148497 GATATTCCTGGTTCCAATGAAGG - Intergenic
1171914231 20:31000847-31000869 GATATTCCTGTTTCCAATGAAGG + Intergenic
1175489634 20:59371165-59371187 GACAATCCGACTCCCAATTCAGG + Intergenic
1176762999 21:12978324-12978346 GATATTCCTGTTTCCAATGAAGG + Intergenic
1176974808 21:15308316-15308338 GTTCATCCTGCTCTCATTGCTGG - Intergenic
1180080063 21:45482568-45482590 GCCAAGCCTGGTCCCAATGCTGG - Intronic
1180425449 22:15175338-15175360 GATATTCCTGTTTCCAATGAAGG + Intergenic
1180426471 22:15194611-15194633 GATATTCCTGTTTCCAATGAAGG + Intergenic
1180452637 22:15480923-15480945 GAAAATACTGCTCCTAATGAAGG - Intergenic
1180505687 22:15998618-15998640 GATAATCCCGTTTCCAATGAAGG + Intergenic
1180507899 22:16035551-16035573 GATAATCCCGTTACCAATGAAGG + Intergenic
1203332971 22_KI270739v1_random:23429-23451 GATAATCCCGTTTCCAATGAAGG - Intergenic
952216758 3:31285628-31285650 GAAAATGCTGCTGACAATGCTGG + Intergenic
952808976 3:37384758-37384780 GGAAATCCTGCTCTCAAGGCAGG - Intergenic
958206529 3:90404195-90404217 GATAATCCCGTTTCCAATGAAGG + Intergenic
958207734 3:90425990-90426012 GATATTCCCGTTCCCAATGAAGG + Intergenic
958766960 3:98380433-98380455 CATAATCCTGATACCAAAGCCGG - Intergenic
961114865 3:124320509-124320531 GAGAAGCCTCCTCCCCATGCTGG - Intronic
965015217 3:163148959-163148981 GATCATCCTGATACCAAAGCCGG - Intergenic
965519624 3:169659597-169659619 GAAAATCCTTCTCCCAACGGAGG - Intronic
966211288 3:177456052-177456074 GATAAGCCTCCTCCCAGTTCAGG + Intergenic
966983684 3:185160810-185160832 GAGCATCTTGCTCACAATGCTGG + Intergenic
974770126 4:66401632-66401654 CATCATCCTGATACCAATGCCGG - Intergenic
975835676 4:78420118-78420140 GATAATTCTGCTCCCACATCTGG + Intronic
976396584 4:84562280-84562302 GATAATTATGTACCCAATGCCGG + Intergenic
976910996 4:90305225-90305247 GTTAATGCTGATCCAAATGCAGG + Intronic
977350466 4:95878775-95878797 GAAAAGCCTGCTTCCAAAGCTGG + Intergenic
983791685 4:171806682-171806704 GATGATCCTGGTGACAATGCAGG - Intergenic
986636775 5:9830032-9830054 GATAAAGCTGCTCCCACAGCAGG + Intergenic
987601911 5:20083435-20083457 GATAGACTTGCTCTCAATGCAGG - Intronic
989860496 5:46369623-46369645 GATATTCCTGTTTCCAATGAAGG - Intergenic
989861243 5:46378567-46378589 GATAATCCTGTTTCCAAAGAAGG - Intergenic
989863284 5:46411459-46411481 GATAATCCCGTTTCCAATGAAGG - Intergenic
989912279 5:49671072-49671094 GATAATCCCGTTTCCAATGAAGG - Intergenic
989913004 5:49682658-49682680 GATAATCCCGTTTCCAATGAAGG - Intergenic
989913536 5:49691175-49691197 GATAATCCCGTTTCCAATGAAGG - Intergenic
989913732 5:49694072-49694094 GATAATCCCGTTTCCAATGAAGG - Intergenic
989914851 5:49711457-49711479 GATAATCCCGTTTCCAATGAAGG - Intergenic
989915229 5:49717245-49717267 GATAATCCTGTTTCCAACGAAGG - Intergenic
991276250 5:64850325-64850347 GACTATCCTTTTCCCAATGCAGG - Intronic
992113814 5:73520902-73520924 GTTAATCCTGTTCACAAGGCTGG - Intergenic
992755945 5:79905948-79905970 GATCATCCTGATACCAAAGCCGG + Intergenic
997622812 5:135309987-135310009 TATAATCCTGCTCCTCTTGCTGG - Intronic
998883931 5:146674669-146674691 GATATTCCTGCTGCCAATGATGG - Intronic
999523138 5:152373350-152373372 GATAATCCTGTTGCCAAAACAGG + Intergenic
1000357042 5:160407986-160408008 GAGAATCCTTATGCCAATGCAGG - Exonic
1202774228 5_GL000208v1_random:49733-49755 GATATTCCTGTTTCCAATGAAGG + Intergenic
1003217597 6:4129010-4129032 GATAATCCATCTCCTAATCCTGG - Intronic
1003774564 6:9346063-9346085 GACAATTCTGCTACCAATTCTGG - Intergenic
1008898565 6:56585076-56585098 CATCATCCTGATCCCAAAGCCGG - Intronic
1008915453 6:56782205-56782227 CATCATCCTGATCCCAAAGCCGG - Intronic
1022180265 7:27912358-27912380 GAAAAGTCTGCTCACAATGCAGG + Intronic
1025315316 7:58017231-58017253 GATATTCCTGTTTCCAATGAAGG - Intergenic
1025473235 7:60885953-60885975 GATAATCCTGTTTCCACTGAAGG + Intergenic
1025494170 7:61176835-61176857 GATAATCCTGCTTCCCAAGAAGG - Intergenic
1025498813 7:61256288-61256310 GATAATCCTGCTTCCCAAGAAGG - Intergenic
1025502993 7:61380137-61380159 GATAATCCTGCTTCCCAAGAAGG - Intergenic
1025513770 7:61603913-61603935 GATAATCCTGTTTCCACTGAAGG - Intergenic
1025538115 7:62032752-62032774 GATAATCCTGTTTCCACTGAAGG - Intergenic
1029302128 7:99589122-99589144 CATATTACTGCTCACAATGCAGG - Intronic
1037530712 8:19770058-19770080 GATAATACTGCTCATGATGCAGG - Intergenic
1040469593 8:47726308-47726330 GATAAATTTTCTCCCAATGCTGG + Intronic
1052512178 9:29435736-29435758 AAAAATCCTGTTCACAATGCAGG - Intergenic
1053712851 9:40839935-40839957 GATAATCCCGTTGCCAATGAAGG - Intergenic
1053938238 9:43193499-43193521 GATATTCCTGTTTCCAATGAAGG - Intergenic
1054423380 9:64973183-64973205 GATAATCCCGTTGCCAATGAAGG - Intergenic
1054836700 9:69682551-69682573 GATCATCCTGATACCAAAGCTGG + Intergenic
1055638919 9:78304268-78304290 GCTAATCCTGCAACCAATGGTGG - Intronic
1056843692 9:90019190-90019212 GCTACTCCTTCTCCCACTGCGGG + Intergenic
1058203194 9:102068982-102069004 AATAATCCTGCTCCTAATCAGGG + Intergenic
1058418802 9:104816055-104816077 GATAATCCTGCTCCCAATGCAGG + Intronic
1058744247 9:107974429-107974451 AATACTCCAGCTCCAAATGCTGG + Intergenic
1062081517 9:134626534-134626556 AATAATCCTGCTCCCCATGATGG + Intergenic
1203417906 Un_KI270362v1:2213-2235 GATATTCCTGTTTCCAATGAAGG + Intergenic
1189446784 X:41086678-41086700 GATAACCCAGCTCCCACTCCAGG - Intronic
1191751355 X:64546299-64546321 CATCATCCTGATCCCAAAGCCGG - Intergenic
1191763312 X:64667450-64667472 GATCATCCTGATACCAAAGCCGG - Intergenic
1192369159 X:70499195-70499217 GATCATCCTGGGCCCAATGAAGG + Exonic
1192933652 X:75835746-75835768 GATCATCCTGATACCAAAGCTGG - Intergenic
1197917947 X:131556339-131556361 GATCATCCTGATACCAAAGCCGG + Intergenic