ID: 1058421058

View in Genome Browser
Species Human (GRCh38)
Location 9:104833870-104833892
Sequence CTCAATCAGCAGATCCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058421053_1058421058 22 Left 1058421053 9:104833825-104833847 CCTCACATGGGTCAACACGAAAG 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1058421058 9:104833870-104833892 CTCAATCAGCAGATCCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058421058 Original CRISPR CTCAATCAGCAGATCCAGAG GGG Intronic
No off target data available for this crispr