ID: 1058424541

View in Genome Browser
Species Human (GRCh38)
Location 9:104864972-104864994
Sequence GGCTGTGCACGTGCATGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058424531_1058424541 30 Left 1058424531 9:104864919-104864941 CCCCCGGATGAGACATAAGAACC 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1058424541 9:104864972-104864994 GGCTGTGCACGTGCATGGTGTGG No data
1058424534_1058424541 27 Left 1058424534 9:104864922-104864944 CCGGATGAGACATAAGAACCCAG 0: 1
1: 0
2: 3
3: 14
4: 143
Right 1058424541 9:104864972-104864994 GGCTGTGCACGTGCATGGTGTGG No data
1058424536_1058424541 8 Left 1058424536 9:104864941-104864963 CCAGAGACTGATTAAACAGTCAA 0: 1
1: 0
2: 1
3: 11
4: 152
Right 1058424541 9:104864972-104864994 GGCTGTGCACGTGCATGGTGTGG No data
1058424533_1058424541 28 Left 1058424533 9:104864921-104864943 CCCGGATGAGACATAAGAACCCA 0: 1
1: 0
2: 1
3: 11
4: 149
Right 1058424541 9:104864972-104864994 GGCTGTGCACGTGCATGGTGTGG No data
1058424532_1058424541 29 Left 1058424532 9:104864920-104864942 CCCCGGATGAGACATAAGAACCC 0: 1
1: 0
2: 1
3: 3
4: 37
Right 1058424541 9:104864972-104864994 GGCTGTGCACGTGCATGGTGTGG No data
1058424535_1058424541 9 Left 1058424535 9:104864940-104864962 CCCAGAGACTGATTAAACAGTCA 0: 1
1: 0
2: 5
3: 14
4: 173
Right 1058424541 9:104864972-104864994 GGCTGTGCACGTGCATGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058424541 Original CRISPR GGCTGTGCACGTGCATGGTG TGG Intronic
No off target data available for this crispr