ID: 1058424839

View in Genome Browser
Species Human (GRCh38)
Location 9:104867223-104867245
Sequence GTGGGGAACAGGAGAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058424830_1058424839 21 Left 1058424830 9:104867179-104867201 CCCAGATCAAGAGGAGAGTCAGG 0: 1
1: 0
2: 0
3: 25
4: 250
Right 1058424839 9:104867223-104867245 GTGGGGAACAGGAGAGAGGAAGG No data
1058424832_1058424839 20 Left 1058424832 9:104867180-104867202 CCAGATCAAGAGGAGAGTCAGGT 0: 1
1: 0
2: 2
3: 16
4: 171
Right 1058424839 9:104867223-104867245 GTGGGGAACAGGAGAGAGGAAGG No data
1058424828_1058424839 30 Left 1058424828 9:104867170-104867192 CCACGTCAGCCCAGATCAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1058424839 9:104867223-104867245 GTGGGGAACAGGAGAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058424839 Original CRISPR GTGGGGAACAGGAGAGAGGA AGG Intronic
No off target data available for this crispr