ID: 1058430909

View in Genome Browser
Species Human (GRCh38)
Location 9:104918388-104918410
Sequence CCACTTTGATAGTTTTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058430909 Original CRISPR CCACTTTGATAGTTTTGTCC TGG (reversed) Intronic
902891760 1:19449223-19449245 CCACTTTGTTCCTGTTGTCCTGG - Intronic
912906893 1:113717327-113717349 CCACTTTGTTAGTTGTTTTCTGG - Intronic
913243906 1:116854879-116854901 CCACTTTGGCAGTTTTCTTCAGG + Intergenic
913384647 1:118246170-118246192 CCACTTCAATAATTTTGTTCTGG - Intergenic
913415416 1:118600647-118600669 ATACTGAGATAGTTTTGTCCTGG - Intergenic
915834243 1:159162128-159162150 TCACTTAAATAGTTTTGTTCAGG - Intergenic
917058669 1:171012796-171012818 ACACAATGATAGTTTTGGCCGGG - Intronic
917465404 1:175271583-175271605 CCCCTTTGATAGTTCCATCCTGG - Intergenic
921989240 1:221346470-221346492 CCTCTTTGAGAATTTTGTCATGG - Intergenic
923509674 1:234639483-234639505 CCACTTTGATGGTATAGACCTGG - Intergenic
924649366 1:245910475-245910497 CAGCTTTGTTCGTTTTGTCCAGG - Intronic
1063419465 10:5900006-5900028 CCACTTTGATGGTTTTGTGCTGG - Intronic
1064570327 10:16685835-16685857 CCACTTTAATAGTTCTCTCTGGG - Intronic
1075518715 10:123130869-123130891 CCACCCTGAAAGTTTTCTCCTGG - Intergenic
1078862397 11:15261845-15261867 CCACTTGTATACTTTTGTGCAGG + Intergenic
1087712046 11:101566176-101566198 TCACTTTGTAAGTTTTGCCCAGG + Intronic
1088797692 11:113277630-113277652 CCACTTTGACAGTCTTGACAAGG - Exonic
1090963462 11:131577843-131577865 CTACTTTGACAGTATTCTCCAGG + Intronic
1096048422 12:48585115-48585137 CCAGTTTGTTAGTTTTATACAGG - Intergenic
1099785805 12:87261869-87261891 CTACGGTGACAGTTTTGTCCTGG + Intergenic
1100103645 12:91141492-91141514 CCACTTTAATTGTCATGTCCTGG + Exonic
1100875961 12:98962034-98962056 CCATTTTGATATTTGTTTCCTGG - Intronic
1101192513 12:102349625-102349647 CCATTTGTATGGTTTTGTCCAGG + Intergenic
1107765050 13:43725668-43725690 CCACTTAGATAGTTTTCGCCTGG + Intronic
1108432932 13:50372323-50372345 CCACTTTAGGAGTTATGTCCCGG + Intronic
1110012903 13:70361616-70361638 CCAATTTGAAATTTTTATCCAGG - Intergenic
1110357934 13:74590000-74590022 CTATTTGGATATTTTTGTCCTGG + Intergenic
1110633100 13:77732882-77732904 CTACTTTGAGACTGTTGTCCTGG + Intronic
1112928006 13:104701116-104701138 CCATTTTAATAATTTTTTCCTGG - Intergenic
1112957553 13:105079972-105079994 CCAGGTTGATATTTTTATCCTGG - Intergenic
1113344971 13:109468210-109468232 CCTCTTTGATAATTTTCTCAAGG + Intergenic
1113434027 13:110275356-110275378 CCACTTTAATAGGTGTGTACTGG - Intronic
1114978739 14:28134962-28134984 GCACTTTGATAGTTTAATCTAGG - Intergenic
1116964484 14:51000049-51000071 CCAGTTCTATAGTTTTGTTCTGG - Intronic
1120105613 14:80490791-80490813 CCACTTTCATATTTTTGTTTTGG + Intronic
1122033958 14:98934113-98934135 CCACTTTTATAATTATGACCTGG + Intergenic
1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG + Intronic
1124549039 15:30660724-30660746 CCACTTGGAGAGTTTGGCCCAGG + Intronic
1126856048 15:52840424-52840446 CTACTTTGATCATTTTGCCCAGG - Intergenic
1129436333 15:75544059-75544081 CCTCTTTGATAACTTTGGCCTGG - Intronic
1129934963 15:79439710-79439732 TCTCATTTATAGTTTTGTCCTGG + Intronic
1130573359 15:85068738-85068760 CCTCTTTCCTAGTCTTGTCCAGG + Intronic
1136280958 16:29210992-29211014 CCACCTTGAAAGTTTTGGCAAGG + Intergenic
1139415200 16:66802040-66802062 CCACTCTGATCCTTTGGTCCAGG - Intergenic
1140655283 16:77133553-77133575 CCACTTCGATAGTATGGTCTGGG - Intergenic
1142085315 16:88176915-88176937 CCACCTTGAAAGTTTTGGCAAGG + Intergenic
1142316479 16:89349762-89349784 CCAACTTCATAGTTTTGTCTTGG - Intronic
1144059371 17:11568606-11568628 ACACTTTGATGGTTTTATCATGG - Intergenic
1146546002 17:33738977-33738999 CCACGATGATTCTTTTGTCCTGG + Intronic
1148012531 17:44494931-44494953 CCACTTCTTTACTTTTGTCCTGG + Intronic
1150833548 17:68543886-68543908 CCACTTTGCTTGTCTTCTCCTGG - Intronic
1153095521 18:1397577-1397599 CCCCTTTGTTATTTTTGCCCGGG + Intergenic
1154134817 18:11767077-11767099 CCAGTTTGATATTTCTGCCCAGG + Intronic
1160011763 18:75111375-75111397 GCACTTTGATTTTTTTCTCCCGG + Intergenic
1164849797 19:31472044-31472066 GCACTTTGAAAAATTTGTCCGGG - Intergenic
1167045109 19:47045252-47045274 CCACTTTGATGCGTTTGCCCTGG - Exonic
925091851 2:1162748-1162770 CAGCTTTGGTAGTTTTCTCCAGG + Intronic
926045733 2:9708322-9708344 CCACTTTGCAAGCTTTGGCCGGG - Intergenic
929803555 2:45124907-45124929 CCAGTTTGATAGTCTTGTCCAGG - Intergenic
929882983 2:45853462-45853484 CCACTGTGCTAATTTTTTCCTGG + Intronic
931208921 2:60173963-60173985 GCACCTTAAAAGTTTTGTCCAGG - Intergenic
934154973 2:89190194-89190216 CCTCTTTTATTTTTTTGTCCTGG - Intergenic
937795800 2:126018797-126018819 GCACTTAGATTGTTTTGTCTTGG + Intergenic
939471298 2:142624532-142624554 CCATTTTGAGAGTTTTCACCTGG - Intergenic
941866177 2:170337019-170337041 CCACGTTGACATTTTTGTCCTGG + Intronic
942694638 2:178627116-178627138 AAACTTTAATAGTTTTGTCATGG - Intronic
942977674 2:182038392-182038414 CCACTAAGATAGTTTACTCCAGG - Intronic
945450262 2:209986296-209986318 CCACTTAGCTAGCTTTGTGCTGG + Intronic
1170077508 20:12435772-12435794 CTTCTTTGATGGTTGTGTCCGGG + Intergenic
1170160610 20:13306611-13306633 CCCCTTAGAGAATTTTGTCCTGG - Intergenic
1171136430 20:22699005-22699027 TCACTTTGATATTTTTATCCAGG - Intergenic
1176265154 20:64205400-64205422 GCACTTTGCTTTTTTTGTCCGGG + Intronic
1180720773 22:17906749-17906771 CCTCTTTGACCGGTTTGTCCAGG - Exonic
1185386761 22:50535881-50535903 CCACTCAGAGAGTTTTGTCATGG + Intergenic
949623328 3:5840867-5840889 CCACATTGATATTTTTATTCAGG - Intergenic
951142424 3:19180190-19180212 CTACTTTGAGAGTTTTGTGAAGG + Intronic
952427886 3:33193913-33193935 CCACTTTGTTAGTTTTGCAAAGG - Intronic
952690135 3:36195931-36195953 CCACTTTGATATACTTGCCCAGG - Intergenic
955044819 3:55350084-55350106 CCACTTTGGAAGCTATGTCCTGG - Intergenic
955494155 3:59513696-59513718 CCACTTTGAAAATTTTATCCTGG - Intergenic
956682112 3:71790499-71790521 CCACTTTGGGAAATTTGTCCTGG + Intergenic
960249326 3:115434959-115434981 CTACTTGGATAGTTGTGCCCTGG + Intergenic
961555621 3:127694971-127694993 TCACCTTGAGAGTCTTGTCCTGG + Exonic
964368782 3:155977180-155977202 CAACTTTGATAGTTATCTCGAGG - Intergenic
965689066 3:171336168-171336190 CCATTTTGTTAGTTTTGACAAGG - Intronic
966800200 3:183756415-183756437 CCAATTTGTTACCTTTGTCCTGG + Intronic
967119981 3:186374171-186374193 CCAGTTTGACATTTTTTTCCTGG - Intergenic
969894871 4:10294149-10294171 CCAATTTGATGCTTTTGTACTGG + Intergenic
971362500 4:25950890-25950912 CCACTTTCATGGTGTTGCCCTGG - Intergenic
973603381 4:52563279-52563301 CCAATTTGAAAGTATTGGCCAGG + Intergenic
974500499 4:62694536-62694558 TCATTTTAATAGTTTTGTCAAGG + Intergenic
977055438 4:92184451-92184473 CTACTCTGATATTTTTATCCAGG - Intergenic
977056453 4:92199150-92199172 CCATTTTGATAGCTTTGTAATGG + Intergenic
978435659 4:108681829-108681851 CCACTTTCATTGTCTTCTCCAGG - Intergenic
979877909 4:125916737-125916759 CCATTTTAATAGTTTTGTTTGGG - Intergenic
981155438 4:141429333-141429355 CCTCTTTCATGGTTTTGTCAAGG - Intergenic
985600057 5:823651-823673 TCACTTTCATAGGATTGTCCTGG + Intronic
988598256 5:32615459-32615481 CAACTTTGATAGTTTTGCCAAGG + Intergenic
990810565 5:59717742-59717764 CCACTATTATTGTTTTGTCAAGG - Intronic
990835246 5:60011996-60012018 CCACTGTGATAGTGATGTCTCGG - Intronic
991992589 5:72355856-72355878 TCTCTTTTATAGTTTGGTCCAGG + Intronic
992523317 5:77579377-77579399 CTACTTTCAAAGTTTTCTCCTGG - Intronic
994365272 5:98908726-98908748 CCACTTTAATACTGTTGTGCTGG - Intronic
996967870 5:129326943-129326965 CCAAATTGATATTTTTTTCCAGG - Intergenic
1002193203 5:177489535-177489557 GCACTGTGCTCGTTTTGTCCGGG + Exonic
1003950163 6:11109237-11109259 ACACTTTGATATATTTGTCAGGG + Intronic
1008666113 6:53718043-53718065 CCACTTTGGAAATTTTTTCCTGG + Intergenic
1010848328 6:80740362-80740384 CAACTTTGTTATTTTTGTTCAGG + Intergenic
1013913913 6:115311231-115311253 TCACTTTGTTAGTTGTTTCCTGG + Intergenic
1015715947 6:136191929-136191951 CCACTTTCTGAGTGTTGTCCTGG + Exonic
1022505000 7:30904201-30904223 CCACTTTGATATATGTGTCCTGG - Intergenic
1024846221 7:53645623-53645645 CCATTGTGATAGTTATGTACTGG + Intergenic
1027524358 7:79247976-79247998 CCATTTTGTTATTTGTGTCCTGG - Intronic
1028781366 7:94740686-94740708 ACACTTTGATATGTTTGTCAAGG + Intergenic
1028797314 7:94918197-94918219 TCACTTTTACAGTTTTCTCCTGG + Intronic
1033633278 7:143182728-143182750 CCACTATGACATTTTTTTCCTGG - Intergenic
1036076853 8:5512121-5512143 CCACTTTGGGGGTGTTGTCCTGG - Intergenic
1037083745 8:14819973-14819995 CCATTTTGTTAGTTGTTTCCTGG - Intronic
1045031410 8:98140014-98140036 CCACCTTCATAATTTTGTCATGG - Intronic
1045272260 8:100671926-100671948 CCAATCAGATAGTTTTGGCCAGG - Intergenic
1057060064 9:91995839-91995861 CCTGTTTGATCGTTTTGCCCTGG - Intergenic
1058294858 9:103293966-103293988 GCACTCTGACAGATTTGTCCTGG - Intergenic
1058430909 9:104918388-104918410 CCACTTTGATAGTTTTGTCCTGG - Intronic
1059548730 9:115205912-115205934 CCCCTTTAATATTTTTCTCCTGG + Intronic
1194125254 X:90008606-90008628 CATCATTGATAGTTTTGCCCAGG + Intergenic
1194169091 X:90559446-90559468 ACACATTGTTAGTTTTGTTCAGG + Intergenic
1197411720 X:126124213-126124235 CCATTTTGATAGTTTAATACTGG - Intergenic
1198451422 X:136769620-136769642 CCTCTTTGATTGCATTGTCCTGG - Intronic
1198644781 X:138794089-138794111 CCACTTTGAGAATTTGTTCCAGG - Intronic
1199490412 X:148392497-148392519 CAGCTTTGATATTTTTGTTCAGG - Intergenic
1199504965 X:148551580-148551602 CAACTTTAAAAGTTTTGTTCTGG + Intronic
1200515328 Y:4137231-4137253 ACACATTGTTAGTTTTGTTCAGG + Intergenic