ID: 1058440472

View in Genome Browser
Species Human (GRCh38)
Location 9:105001981-105002003
Sequence GCCATTAAAAATAATGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058440470_1058440472 3 Left 1058440470 9:105001955-105001977 CCATTCATACTAGGGAATCGTAT No data
Right 1058440472 9:105001981-105002003 GCCATTAAAAATAATGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058440472 Original CRISPR GCCATTAAAAATAATGAGGT AGG Intergenic
No off target data available for this crispr