ID: 1058443939

View in Genome Browser
Species Human (GRCh38)
Location 9:105036859-105036881
Sequence CCGTCAGACCATTAGTATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058443939_1058443944 1 Left 1058443939 9:105036859-105036881 CCCCAATACTAATGGTCTGACGG No data
Right 1058443944 9:105036883-105036905 AGAGAGGTGTACATATATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058443939 Original CRISPR CCGTCAGACCATTAGTATTG GGG (reversed) Intergenic
No off target data available for this crispr