ID: 1058447161

View in Genome Browser
Species Human (GRCh38)
Location 9:105064430-105064452
Sequence ATGACATCCTAGAAATTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058447161_1058447173 24 Left 1058447161 9:105064430-105064452 CCCAGGAATTTCTAGGATGTCAT No data
Right 1058447173 9:105064477-105064499 GGTTATGCCAGAAGCATAGTGGG No data
1058447161_1058447176 30 Left 1058447161 9:105064430-105064452 CCCAGGAATTTCTAGGATGTCAT No data
Right 1058447176 9:105064483-105064505 GCCAGAAGCATAGTGGGGAAGGG No data
1058447161_1058447165 -4 Left 1058447161 9:105064430-105064452 CCCAGGAATTTCTAGGATGTCAT No data
Right 1058447165 9:105064449-105064471 TCATGCCTGAGGAGCCCTGTGGG No data
1058447161_1058447167 1 Left 1058447161 9:105064430-105064452 CCCAGGAATTTCTAGGATGTCAT No data
Right 1058447167 9:105064454-105064476 CCTGAGGAGCCCTGTGGGAGAGG No data
1058447161_1058447169 3 Left 1058447161 9:105064430-105064452 CCCAGGAATTTCTAGGATGTCAT No data
Right 1058447169 9:105064456-105064478 TGAGGAGCCCTGTGGGAGAGGGG No data
1058447161_1058447174 25 Left 1058447161 9:105064430-105064452 CCCAGGAATTTCTAGGATGTCAT No data
Right 1058447174 9:105064478-105064500 GTTATGCCAGAAGCATAGTGGGG No data
1058447161_1058447168 2 Left 1058447161 9:105064430-105064452 CCCAGGAATTTCTAGGATGTCAT No data
Right 1058447168 9:105064455-105064477 CTGAGGAGCCCTGTGGGAGAGGG No data
1058447161_1058447172 23 Left 1058447161 9:105064430-105064452 CCCAGGAATTTCTAGGATGTCAT No data
Right 1058447172 9:105064476-105064498 GGGTTATGCCAGAAGCATAGTGG No data
1058447161_1058447164 -5 Left 1058447161 9:105064430-105064452 CCCAGGAATTTCTAGGATGTCAT No data
Right 1058447164 9:105064448-105064470 GTCATGCCTGAGGAGCCCTGTGG No data
1058447161_1058447175 29 Left 1058447161 9:105064430-105064452 CCCAGGAATTTCTAGGATGTCAT No data
Right 1058447175 9:105064482-105064504 TGCCAGAAGCATAGTGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058447161 Original CRISPR ATGACATCCTAGAAATTCCT GGG (reversed) Intergenic
No off target data available for this crispr