ID: 1058447171

View in Genome Browser
Species Human (GRCh38)
Location 9:105064464-105064486
Sequence TGGCATAACCCCTCTCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058447171_1058447176 -4 Left 1058447171 9:105064464-105064486 CCTGTGGGAGAGGGGTTATGCCA No data
Right 1058447176 9:105064483-105064505 GCCAGAAGCATAGTGGGGAAGGG No data
1058447171_1058447174 -9 Left 1058447171 9:105064464-105064486 CCTGTGGGAGAGGGGTTATGCCA No data
Right 1058447174 9:105064478-105064500 GTTATGCCAGAAGCATAGTGGGG No data
1058447171_1058447178 8 Left 1058447171 9:105064464-105064486 CCTGTGGGAGAGGGGTTATGCCA No data
Right 1058447178 9:105064495-105064517 GTGGGGAAGGGAGCAAAAAGAGG No data
1058447171_1058447173 -10 Left 1058447171 9:105064464-105064486 CCTGTGGGAGAGGGGTTATGCCA No data
Right 1058447173 9:105064477-105064499 GGTTATGCCAGAAGCATAGTGGG No data
1058447171_1058447175 -5 Left 1058447171 9:105064464-105064486 CCTGTGGGAGAGGGGTTATGCCA No data
Right 1058447175 9:105064482-105064504 TGCCAGAAGCATAGTGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058447171 Original CRISPR TGGCATAACCCCTCTCCCAC AGG (reversed) Intergenic
No off target data available for this crispr