ID: 1058447175

View in Genome Browser
Species Human (GRCh38)
Location 9:105064482-105064504
Sequence TGCCAGAAGCATAGTGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058447170_1058447175 -4 Left 1058447170 9:105064463-105064485 CCCTGTGGGAGAGGGGTTATGCC No data
Right 1058447175 9:105064482-105064504 TGCCAGAAGCATAGTGGGGAAGG No data
1058447162_1058447175 28 Left 1058447162 9:105064431-105064453 CCAGGAATTTCTAGGATGTCATG No data
Right 1058447175 9:105064482-105064504 TGCCAGAAGCATAGTGGGGAAGG No data
1058447166_1058447175 5 Left 1058447166 9:105064454-105064476 CCTGAGGAGCCCTGTGGGAGAGG No data
Right 1058447175 9:105064482-105064504 TGCCAGAAGCATAGTGGGGAAGG No data
1058447161_1058447175 29 Left 1058447161 9:105064430-105064452 CCCAGGAATTTCTAGGATGTCAT No data
Right 1058447175 9:105064482-105064504 TGCCAGAAGCATAGTGGGGAAGG No data
1058447171_1058447175 -5 Left 1058447171 9:105064464-105064486 CCTGTGGGAGAGGGGTTATGCCA No data
Right 1058447175 9:105064482-105064504 TGCCAGAAGCATAGTGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058447175 Original CRISPR TGCCAGAAGCATAGTGGGGA AGG Intergenic
No off target data available for this crispr