ID: 1058450144

View in Genome Browser
Species Human (GRCh38)
Location 9:105088910-105088932
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058450144_1058450148 -10 Left 1058450144 9:105088910-105088932 CCTTCACCTGGCTCCCTTGGAAA No data
Right 1058450148 9:105088923-105088945 CCCTTGGAAAATGCATTTTTGGG No data
1058450144_1058450150 -9 Left 1058450144 9:105088910-105088932 CCTTCACCTGGCTCCCTTGGAAA No data
Right 1058450150 9:105088924-105088946 CCTTGGAAAATGCATTTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058450144 Original CRISPR TTTCCAAGGGAGCCAGGTGA AGG (reversed) Intergenic
No off target data available for this crispr