ID: 1058450445

View in Genome Browser
Species Human (GRCh38)
Location 9:105091430-105091452
Sequence CTGAACCTTGATCTGGAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058450445_1058450453 24 Left 1058450445 9:105091430-105091452 CCGGGCTCCAGATCAAGGTTCAG No data
Right 1058450453 9:105091477-105091499 ACTGGGATATCCTGCCATAGAGG No data
1058450445_1058450449 6 Left 1058450445 9:105091430-105091452 CCGGGCTCCAGATCAAGGTTCAG No data
Right 1058450449 9:105091459-105091481 CTTCTTTCTCTCTGCCCAACTGG No data
1058450445_1058450455 28 Left 1058450445 9:105091430-105091452 CCGGGCTCCAGATCAAGGTTCAG No data
Right 1058450455 9:105091481-105091503 GGATATCCTGCCATAGAGGTGGG No data
1058450445_1058450456 29 Left 1058450445 9:105091430-105091452 CCGGGCTCCAGATCAAGGTTCAG No data
Right 1058450456 9:105091482-105091504 GATATCCTGCCATAGAGGTGGGG No data
1058450445_1058450450 7 Left 1058450445 9:105091430-105091452 CCGGGCTCCAGATCAAGGTTCAG No data
Right 1058450450 9:105091460-105091482 TTCTTTCTCTCTGCCCAACTGGG No data
1058450445_1058450454 27 Left 1058450445 9:105091430-105091452 CCGGGCTCCAGATCAAGGTTCAG No data
Right 1058450454 9:105091480-105091502 GGGATATCCTGCCATAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058450445 Original CRISPR CTGAACCTTGATCTGGAGCC CGG (reversed) Intergenic
No off target data available for this crispr