ID: 1058450446

View in Genome Browser
Species Human (GRCh38)
Location 9:105091437-105091459
Sequence GGAGGAGCTGAACCTTGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058450446_1058450453 17 Left 1058450446 9:105091437-105091459 CCAGATCAAGGTTCAGCTCCTCC No data
Right 1058450453 9:105091477-105091499 ACTGGGATATCCTGCCATAGAGG No data
1058450446_1058450456 22 Left 1058450446 9:105091437-105091459 CCAGATCAAGGTTCAGCTCCTCC No data
Right 1058450456 9:105091482-105091504 GATATCCTGCCATAGAGGTGGGG No data
1058450446_1058450455 21 Left 1058450446 9:105091437-105091459 CCAGATCAAGGTTCAGCTCCTCC No data
Right 1058450455 9:105091481-105091503 GGATATCCTGCCATAGAGGTGGG No data
1058450446_1058450454 20 Left 1058450446 9:105091437-105091459 CCAGATCAAGGTTCAGCTCCTCC No data
Right 1058450454 9:105091480-105091502 GGGATATCCTGCCATAGAGGTGG No data
1058450446_1058450450 0 Left 1058450446 9:105091437-105091459 CCAGATCAAGGTTCAGCTCCTCC No data
Right 1058450450 9:105091460-105091482 TTCTTTCTCTCTGCCCAACTGGG No data
1058450446_1058450449 -1 Left 1058450446 9:105091437-105091459 CCAGATCAAGGTTCAGCTCCTCC No data
Right 1058450449 9:105091459-105091481 CTTCTTTCTCTCTGCCCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058450446 Original CRISPR GGAGGAGCTGAACCTTGATC TGG (reversed) Intergenic
No off target data available for this crispr