ID: 1058450447

View in Genome Browser
Species Human (GRCh38)
Location 9:105091455-105091477
Sequence TTGGGCAGAGAGAAAGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058450447_1058450456 4 Left 1058450447 9:105091455-105091477 CCTCCTTCTTTCTCTCTGCCCAA No data
Right 1058450456 9:105091482-105091504 GATATCCTGCCATAGAGGTGGGG No data
1058450447_1058450455 3 Left 1058450447 9:105091455-105091477 CCTCCTTCTTTCTCTCTGCCCAA No data
Right 1058450455 9:105091481-105091503 GGATATCCTGCCATAGAGGTGGG No data
1058450447_1058450453 -1 Left 1058450447 9:105091455-105091477 CCTCCTTCTTTCTCTCTGCCCAA No data
Right 1058450453 9:105091477-105091499 ACTGGGATATCCTGCCATAGAGG No data
1058450447_1058450454 2 Left 1058450447 9:105091455-105091477 CCTCCTTCTTTCTCTCTGCCCAA No data
Right 1058450454 9:105091480-105091502 GGGATATCCTGCCATAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058450447 Original CRISPR TTGGGCAGAGAGAAAGAAGG AGG (reversed) Intergenic
No off target data available for this crispr