ID: 1058450449

View in Genome Browser
Species Human (GRCh38)
Location 9:105091459-105091481
Sequence CTTCTTTCTCTCTGCCCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058450436_1058450449 27 Left 1058450436 9:105091409-105091431 CCCCTCCCCAGGGACTCTAAGCC No data
Right 1058450449 9:105091459-105091481 CTTCTTTCTCTCTGCCCAACTGG No data
1058450446_1058450449 -1 Left 1058450446 9:105091437-105091459 CCAGATCAAGGTTCAGCTCCTCC No data
Right 1058450449 9:105091459-105091481 CTTCTTTCTCTCTGCCCAACTGG No data
1058450438_1058450449 25 Left 1058450438 9:105091411-105091433 CCTCCCCAGGGACTCTAAGCCGG No data
Right 1058450449 9:105091459-105091481 CTTCTTTCTCTCTGCCCAACTGG No data
1058450443_1058450449 20 Left 1058450443 9:105091416-105091438 CCAGGGACTCTAAGCCGGGCTCC No data
Right 1058450449 9:105091459-105091481 CTTCTTTCTCTCTGCCCAACTGG No data
1058450441_1058450449 22 Left 1058450441 9:105091414-105091436 CCCCAGGGACTCTAAGCCGGGCT No data
Right 1058450449 9:105091459-105091481 CTTCTTTCTCTCTGCCCAACTGG No data
1058450445_1058450449 6 Left 1058450445 9:105091430-105091452 CCGGGCTCCAGATCAAGGTTCAG No data
Right 1058450449 9:105091459-105091481 CTTCTTTCTCTCTGCCCAACTGG No data
1058450442_1058450449 21 Left 1058450442 9:105091415-105091437 CCCAGGGACTCTAAGCCGGGCTC No data
Right 1058450449 9:105091459-105091481 CTTCTTTCTCTCTGCCCAACTGG No data
1058450437_1058450449 26 Left 1058450437 9:105091410-105091432 CCCTCCCCAGGGACTCTAAGCCG No data
Right 1058450449 9:105091459-105091481 CTTCTTTCTCTCTGCCCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058450449 Original CRISPR CTTCTTTCTCTCTGCCCAAC TGG Intergenic
No off target data available for this crispr