ID: 1058450454

View in Genome Browser
Species Human (GRCh38)
Location 9:105091480-105091502
Sequence GGGATATCCTGCCATAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058450447_1058450454 2 Left 1058450447 9:105091455-105091477 CCTCCTTCTTTCTCTCTGCCCAA No data
Right 1058450454 9:105091480-105091502 GGGATATCCTGCCATAGAGGTGG No data
1058450445_1058450454 27 Left 1058450445 9:105091430-105091452 CCGGGCTCCAGATCAAGGTTCAG No data
Right 1058450454 9:105091480-105091502 GGGATATCCTGCCATAGAGGTGG No data
1058450446_1058450454 20 Left 1058450446 9:105091437-105091459 CCAGATCAAGGTTCAGCTCCTCC No data
Right 1058450454 9:105091480-105091502 GGGATATCCTGCCATAGAGGTGG No data
1058450448_1058450454 -1 Left 1058450448 9:105091458-105091480 CCTTCTTTCTCTCTGCCCAACTG No data
Right 1058450454 9:105091480-105091502 GGGATATCCTGCCATAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058450454 Original CRISPR GGGATATCCTGCCATAGAGG TGG Intergenic
No off target data available for this crispr