ID: 1058453225

View in Genome Browser
Species Human (GRCh38)
Location 9:105116121-105116143
Sequence CCTTATATGCTGTATCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058453225_1058453228 9 Left 1058453225 9:105116121-105116143 CCATGCAGATACAGCATATAAGG No data
Right 1058453228 9:105116153-105116175 CACCTTCCCCTGGAGTTGTCAGG No data
1058453225_1058453233 17 Left 1058453225 9:105116121-105116143 CCATGCAGATACAGCATATAAGG No data
Right 1058453233 9:105116161-105116183 CCTGGAGTTGTCAGGTGACCTGG No data
1058453225_1058453227 -1 Left 1058453225 9:105116121-105116143 CCATGCAGATACAGCATATAAGG No data
Right 1058453227 9:105116143-105116165 GCATTTGCTGCACCTTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058453225 Original CRISPR CCTTATATGCTGTATCTGCA TGG (reversed) Intergenic
No off target data available for this crispr