ID: 1058463933

View in Genome Browser
Species Human (GRCh38)
Location 9:105209617-105209639
Sequence ATGGAGACTCAGAAGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058463933_1058463937 -3 Left 1058463933 9:105209617-105209639 CCCTTCTCCTTCTGAGTCTCCAT No data
Right 1058463937 9:105209637-105209659 CATAGTCCATTACATCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058463933 Original CRISPR ATGGAGACTCAGAAGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr