ID: 1058464272

View in Genome Browser
Species Human (GRCh38)
Location 9:105212478-105212500
Sequence GCTCCCTCAACCATAACCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058464272_1058464275 25 Left 1058464272 9:105212478-105212500 CCATGGGTTATGGTTGAGGGAGC No data
Right 1058464275 9:105212526-105212548 AAAAGAAACAAACATTTATTTGG No data
1058464272_1058464276 26 Left 1058464272 9:105212478-105212500 CCATGGGTTATGGTTGAGGGAGC No data
Right 1058464276 9:105212527-105212549 AAAGAAACAAACATTTATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058464272 Original CRISPR GCTCCCTCAACCATAACCCA TGG (reversed) Intergenic
No off target data available for this crispr