ID: 1058469314 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:105260942-105260964 |
| Sequence | TATTGAATACATATGGAACA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1058469310_1058469314 | 8 | Left | 1058469310 | 9:105260911-105260933 | CCAAGCAAATAATAGATCCTCAA | 0: 1 1: 1 2: 14 3: 200 4: 1206 |
||
| Right | 1058469314 | 9:105260942-105260964 | TATTGAATACATATGGAACAGGG | No data | ||||
| 1058469311_1058469314 | -9 | Left | 1058469311 | 9:105260928-105260950 | CCTCAATAAATGTTTATTGAATA | 0: 3 1: 7 2: 77 3: 405 4: 1442 |
||
| Right | 1058469314 | 9:105260942-105260964 | TATTGAATACATATGGAACAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1058469314 | Original CRISPR | TATTGAATACATATGGAACA GGG | Intronic | ||
| No off target data available for this crispr | |||||