ID: 1058469314

View in Genome Browser
Species Human (GRCh38)
Location 9:105260942-105260964
Sequence TATTGAATACATATGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058469310_1058469314 8 Left 1058469310 9:105260911-105260933 CCAAGCAAATAATAGATCCTCAA 0: 1
1: 1
2: 14
3: 200
4: 1206
Right 1058469314 9:105260942-105260964 TATTGAATACATATGGAACAGGG No data
1058469311_1058469314 -9 Left 1058469311 9:105260928-105260950 CCTCAATAAATGTTTATTGAATA 0: 3
1: 7
2: 77
3: 405
4: 1442
Right 1058469314 9:105260942-105260964 TATTGAATACATATGGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058469314 Original CRISPR TATTGAATACATATGGAACA GGG Intronic
No off target data available for this crispr