ID: 1058472939

View in Genome Browser
Species Human (GRCh38)
Location 9:105299719-105299741
Sequence TAGGACAGGCAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 847
Summary {0: 1, 1: 0, 2: 6, 3: 69, 4: 771}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058472939_1058472950 28 Left 1058472939 9:105299719-105299741 CCTTCCTCCTTCTGCCTGTCCTA 0: 1
1: 0
2: 6
3: 69
4: 771
Right 1058472950 9:105299770-105299792 AATGAGTGGCATCTTTCGATTGG 0: 1
1: 0
2: 0
3: 8
4: 71
1058472939_1058472949 14 Left 1058472939 9:105299719-105299741 CCTTCCTCCTTCTGCCTGTCCTA 0: 1
1: 0
2: 6
3: 69
4: 771
Right 1058472949 9:105299756-105299778 TCTGTGTCTGCTGTAATGAGTGG 0: 1
1: 1
2: 2
3: 17
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058472939 Original CRISPR TAGGACAGGCAGAAGGAGGA AGG (reversed) Intronic
900093819 1:932304-932326 GAGGCCAGGCAGACGGAGGAGGG - Intronic
900296627 1:1955153-1955175 GAAGACAGACAGGAGGAGGACGG + Intronic
900810572 1:4798569-4798591 TTGGACAGGCAGGAAGAGGAGGG - Intergenic
900966230 1:5960632-5960654 CATGACAGGTAGAAGGAGGCTGG + Intronic
901193444 1:7426094-7426116 TGGGACTAGCAGAAGGAGGGAGG - Intronic
901530868 1:9851773-9851795 CAGGACAGGCAGTGGCAGGAGGG + Intronic
901639914 1:10687967-10687989 TAGTGGGGGCAGAAGGAGGAAGG - Intronic
901704534 1:11063412-11063434 TGGGACAGGACTAAGGAGGATGG - Intergenic
901773416 1:11542917-11542939 GAGAAGAGGCAGGAGGAGGATGG - Intergenic
902444210 1:16451835-16451857 TAGAACATGAAGAAGAAGGAAGG + Exonic
902868765 1:19299489-19299511 TATGAAAGACTGAAGGAGGAGGG - Intergenic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903331766 1:22600238-22600260 AAGGAAGGACAGAAGGAGGAAGG + Intronic
903799465 1:25955736-25955758 GAGGGAAGGAAGAAGGAGGAAGG + Intergenic
903841561 1:26245401-26245423 TAGGAAAGGCAAGAGGAGGCAGG - Intronic
904010052 1:27384075-27384097 TAGGAGAAGCAGATGGGGGAAGG - Intergenic
904047656 1:27618183-27618205 GAGGGCAGGCAGGAGGGGGACGG + Intronic
904052425 1:27647768-27647790 CAGGGCCGGGAGAAGGAGGAGGG + Intergenic
904198758 1:28805481-28805503 TAGGTCTGCCAGGAGGAGGAGGG - Intergenic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
905167867 1:36093631-36093653 TAGGACAGACAGACGCAGGCGGG + Exonic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905257366 1:36693465-36693487 GAGGAGAGACAAAAGGAGGAAGG + Intergenic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906291870 1:44624662-44624684 AAGGACAGGGAGAAGGAGGGAGG + Intronic
906391847 1:45424293-45424315 GAGGCCAGGCAGAAGAGGGAAGG + Intronic
906559841 1:46748433-46748455 TGGGACAGGCAGCAGGCGCATGG + Intergenic
907837592 1:58125937-58125959 TATGACAGGCCCCAGGAGGAAGG + Intronic
908182391 1:61618883-61618905 ATGGGCAGGCAGAAGGGGGAGGG + Intergenic
910280956 1:85501289-85501311 AAGGCCAGGCGGTAGGAGGAGGG - Intronic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910386757 1:86692563-86692585 TAGGCCAGGAAGAAGGAAGAAGG + Intergenic
911341504 1:96644262-96644284 TAGGACAGGAAGAATGAAAAGGG - Intergenic
912197734 1:107419138-107419160 GAAGACAGGAAAAAGGAGGAAGG - Intronic
912560555 1:110548428-110548450 AAGGACAGAGAGAAGGAGAAGGG + Intergenic
912595354 1:110870661-110870683 TGGGACAGGCAGAGAGAGTAAGG - Intergenic
913688639 1:121257518-121257540 CAGGACAGGCAGAAAGATGATGG - Intronic
914044643 1:144080533-144080555 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
914133467 1:144880153-144880175 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
914148960 1:145022758-145022780 CAGGACAGGCAGAAAGATGATGG + Intronic
915086314 1:153391242-153391264 TAGGAGAAGCGGAAAGAGGAAGG + Intergenic
915100372 1:153495039-153495061 GAGGGCAGGCAGAGGAAGGAGGG - Intergenic
915296097 1:154922967-154922989 TAGCACAGGCTGAAGGAGAGAGG - Intergenic
915532264 1:156509522-156509544 TAGGATGGGCAGAAGGACAAGGG + Intergenic
915915403 1:159937635-159937657 AAGGACGGGGAGGAGGAGGATGG - Intronic
916191405 1:162182064-162182086 TAGTACATGAAGAAGGAAGATGG - Intronic
916548376 1:165827799-165827821 TCGCACAGGCAGCGGGAGGAGGG + Exonic
917123794 1:171668014-171668036 CACGACTGGAAGAAGGAGGAAGG + Intergenic
917343120 1:174001043-174001065 TGGGACAGGCATAAAGAGAAGGG + Intronic
917498450 1:175564239-175564261 CAGGGCAGGCAGCAGGAGGGAGG - Intronic
917854533 1:179090032-179090054 AAGGACAGGCAGCTGGAGGGTGG - Intronic
917927875 1:179803979-179804001 CAGGCCAGGCGGCAGGAGGAGGG + Intronic
918238368 1:182601008-182601030 GAGGTCAGGCATGAGGAGGATGG - Intronic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
919932304 1:202229296-202229318 TGGGGCAGGGAGAAGGAGAAGGG - Intronic
920110500 1:203583857-203583879 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920110526 1:203583962-203583984 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920206977 1:204299350-204299372 GAGGACAGGAAGAAAGAGGAGGG + Intronic
920475963 1:206276019-206276041 CAGGACAGGCAGAAAGATGATGG - Intronic
920517533 1:206597372-206597394 TAGGAAAAGCAGGAGGTGGAAGG + Intronic
921382539 1:214539655-214539677 AAGGAAGGGAAGAAGGAGGAGGG + Intronic
922106333 1:222516603-222516625 GAGGACAGGCAGGGGCAGGAGGG + Intergenic
922426483 1:225500987-225501009 TATGACAGGCTGAAGCAGGTGGG - Exonic
923022505 1:230175648-230175670 GAGGACAGTGAGGAGGAGGAGGG - Intronic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
924078672 1:240369143-240369165 TAGAAAAGGCAGGAGGTGGAGGG - Intronic
924131201 1:240910432-240910454 TGGGATAGGCAGGAGGAAGAGGG + Intronic
924660034 1:246007511-246007533 AAGAAAAGGCAGAAGGAGGCCGG + Intronic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1062970134 10:1641626-1641648 TAAGACGTGCAGATGGAGGAGGG - Intronic
1063069151 10:2642214-2642236 TATGACAGTCAGAAGGTGGTGGG + Intergenic
1063908970 10:10810651-10810673 GGAGACCGGCAGAAGGAGGAAGG + Intergenic
1064681563 10:17815525-17815547 TAGGGCGGTCAGCAGGAGGAAGG + Intronic
1065010735 10:21418571-21418593 GAGGACGGACAGAAGGAGCAAGG - Intergenic
1065377463 10:25058155-25058177 GAGGACAAGTAGAGGGAGGAAGG - Intronic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1067842025 10:49688640-49688662 GAGGATAGGCAGAAGCAGGAGGG - Intronic
1068114139 10:52718245-52718267 TAGTACAGGCAGAGATAGGATGG + Intergenic
1068122116 10:52791764-52791786 GAGGAGGGGGAGAAGGAGGAAGG + Intergenic
1068946091 10:62730238-62730260 TGGGACAGCCAGAGGGAGGATGG - Intergenic
1069335146 10:67340174-67340196 AAGGGCAGGAGGAAGGAGGAGGG + Intronic
1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG + Intronic
1069979562 10:72242800-72242822 TAGGAGGGGCAGCAGGAAGAGGG + Intergenic
1070026548 10:72637499-72637521 TATGAAAGGGAGAAGGAAGACGG + Intergenic
1070325300 10:75384886-75384908 TTGGAGAGGCAGAGGGATGAAGG - Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070439964 10:76433478-76433500 TTGGACAGGCAGGTGGAGCACGG + Intronic
1070441162 10:76444757-76444779 TAGGCCAGGAAGAAGGACAATGG + Intronic
1070453035 10:76581099-76581121 TGGAAGAGGCAGAAAGAGGAAGG + Intergenic
1070538022 10:77393888-77393910 CAGGACCGGCAGAAGCAGGCCGG + Intronic
1070628568 10:78068221-78068243 GGGGACAGACAGAAGGAGGATGG + Intergenic
1070702465 10:78613557-78613579 GAGGAAAGGGGGAAGGAGGAAGG + Intergenic
1070853357 10:79585249-79585271 CAGGCCAGGCACAAGGAGAAGGG + Intergenic
1070982166 10:80657748-80657770 TAGGAGAGGCAGATGCAGGTTGG - Intergenic
1071102295 10:82053294-82053316 TATTAAAGGCAGAAGGATGAGGG + Intronic
1071315957 10:84398241-84398263 GAAGACAGACAGAAGGAGAATGG - Intronic
1071468456 10:85961733-85961755 AAGGAAAGATAGAAGGAGGATGG - Intronic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072618412 10:97064465-97064487 TAGGATAGGGAGATGGAGCAGGG + Intronic
1072758698 10:98038418-98038440 GGGCACAGGCAGCAGGAGGAGGG + Intergenic
1072885912 10:99273713-99273735 AAGGACAGACAGATGGATGATGG + Intergenic
1073340915 10:102743990-102744012 GAGGAGAGGGAGGAGGAGGAGGG + Exonic
1074086790 10:110214415-110214437 TGGGAAAGGCAGCAGGAGGGGGG - Intronic
1074135543 10:110623334-110623356 AAGGACAGAGAGTAGGAGGAGGG - Intergenic
1074561884 10:114542520-114542542 GAAGAAAGGAAGAAGGAGGAGGG + Intronic
1074774071 10:116753534-116753556 TATGACAGGCAGGATGAGGCAGG - Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075573759 10:123563588-123563610 CAGGACAGACAGAATGAGTAGGG - Intergenic
1075600190 10:123761910-123761932 GAGGACTTCCAGAAGGAGGAGGG - Exonic
1076009359 10:126974994-126975016 TATGGGAGGCAGGAGGAGGAAGG - Intronic
1076055408 10:127368376-127368398 CAGGACAGGAAGAAGCAGCAGGG - Intronic
1076121392 10:127939748-127939770 AAGGAGAGGCAGGAGGAGGCAGG + Intronic
1076163993 10:128267783-128267805 GAGGAAAGGAAGGAGGAGGAAGG - Intergenic
1076358534 10:129870188-129870210 AAATACAGGCAGAAGGAAGATGG - Intronic
1076445117 10:130509158-130509180 TGGGACTGGCAGGAGGAGGCTGG + Intergenic
1076581607 10:131515915-131515937 TGGGCCAGGCAGAAGGAGATGGG - Intergenic
1076676062 10:132148442-132148464 GAGGACGGGCAGATGGAGGACGG - Intronic
1076676066 10:132148457-132148479 GAGGACGGGCGGATGGAGGACGG - Intronic
1076676082 10:132148506-132148528 GAGGACGGGCGGATGGAGGACGG - Intronic
1076685385 10:132196321-132196343 TAGGACGAGCAGAAGGATGAGGG - Intronic
1076856324 10:133117073-133117095 AGGCACAGGCAGAAGGGGGAAGG + Intronic
1077015127 11:395958-395980 AGGGACAGGCAGGAGGAGGATGG - Intronic
1077159988 11:1108307-1108329 AAGGGCAGGCTGAAGGAGGAGGG - Intergenic
1077220667 11:1414239-1414261 GAGGCCGGGCAGGAGGAGGACGG + Intronic
1077251572 11:1563130-1563152 GAGGCCAGGCAGAAGGAGCCTGG + Intronic
1077301922 11:1851472-1851494 GAGGACAGGCAGGTGGAGGCTGG - Intergenic
1077484811 11:2833791-2833813 TGGGACAGGCAGCTGGGGGAAGG + Intronic
1077887240 11:6395210-6395232 CAGCAGGGGCAGAAGGAGGAAGG - Exonic
1078001410 11:7499680-7499702 TAGGAGAAGCAGAAGGAACATGG + Intronic
1078127696 11:8584635-8584657 AGGGCCAGGCATAAGGAGGAAGG - Intronic
1079065401 11:17286727-17286749 AAGGACAGGCAATAGGAAGAAGG - Intronic
1080290546 11:30666053-30666075 TAGAACAAGAAGAAGGAGAAGGG + Intergenic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1081525491 11:43924897-43924919 TAGGAAAGTCAGAGAGAGGAGGG + Intergenic
1081588932 11:44407536-44407558 TAGGACTGGGAGATGGGGGAAGG - Intergenic
1081659487 11:44879267-44879289 TAGGGAAAGAAGAAGGAGGAAGG - Intronic
1081762317 11:45584967-45584989 GAGGACAGGCAGAAGAAGGTAGG - Intergenic
1082788394 11:57330347-57330369 TTGGAGAGGATGAAGGAGGAAGG - Exonic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083229505 11:61307089-61307111 TTGGCCAGGCAAAAGGAGGTGGG - Intronic
1083300106 11:61735679-61735701 GAGGACAGGAAGAGGGAGGCAGG - Intronic
1083499097 11:63087281-63087303 GAGGGCAGGCAGAAGCAGGGTGG + Intronic
1083904214 11:65659688-65659710 AAGGACAGGCGGCAGGCGGAGGG + Exonic
1084911913 11:72396277-72396299 GAGAAAAGGCAGAAGGAGGGAGG + Intronic
1085322756 11:75584608-75584630 AAGGACTGGGAGGAGGAGGAAGG + Intergenic
1086495240 11:87397504-87397526 TAGGACTGGCAGAAGCAGAGAGG - Intergenic
1086592314 11:88530136-88530158 TTGGACAGGTAGAATGAGCATGG - Intronic
1087150436 11:94854884-94854906 AAGGACAGGCAGCAGGAATAGGG - Intronic
1087953946 11:104260157-104260179 TAGAAAAGTCACAAGGAGGAAGG + Intergenic
1088366320 11:109043893-109043915 CAGGAAAGGCAGGAGGTGGAAGG + Intergenic
1089157000 11:116410175-116410197 TACGACAGGCTGGAGGAGGAAGG + Intergenic
1089304549 11:117518212-117518234 CTGGACAGGAGGAAGGAGGAGGG + Intronic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089763985 11:120749654-120749676 GAGGACAGACAGCAGGAAGATGG + Intronic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1091025170 11:132135485-132135507 GAGAACAGGCAGAAGGTGTAAGG + Intronic
1091283687 11:134396503-134396525 TAGCAGAGGCAGAAAGAGGCTGG - Intronic
1091296417 11:134477008-134477030 TAGGACAGAGAGGAGGAGGAGGG + Intergenic
1091686537 12:2566653-2566675 AACCACAGGCAGAAGGTGGAGGG + Intronic
1091751392 12:3023253-3023275 TAGTAAAGGCAGAAGGAAGTGGG + Intronic
1092240649 12:6834125-6834147 CAGGACAGGCAGAATGAAGGGGG - Intronic
1092818512 12:12331703-12331725 TCTGACAGGGAGGAGGAGGAGGG + Intronic
1093512175 12:19942388-19942410 TGGGACAGGCAGAAGTGGTACGG + Intergenic
1093772586 12:23034865-23034887 GAGGAAAGGAAGAAGGAGGGAGG - Intergenic
1096016365 12:48279516-48279538 AAAGAGAGGCAGAGGGAGGATGG - Intergenic
1096510089 12:52122893-52122915 AAAGACATGTAGAAGGAGGAAGG - Intergenic
1096514760 12:52149717-52149739 CAGGACAGGGGGCAGGAGGAGGG - Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1097616641 12:61891682-61891704 TAGGAGGAGGAGAAGGAGGAGGG + Intronic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1098179612 12:67832259-67832281 CAGGAGAGGCAGATGGAAGATGG + Intergenic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098990373 12:77059299-77059321 CAGGACAGACAGATGGAGCAAGG - Intronic
1099239015 12:80116345-80116367 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1099849507 12:88074642-88074664 TAGGGCAGGTGAAAGGAGGATGG - Intronic
1100478175 12:94953096-94953118 CAGGACATGCAGCAGGAGTATGG - Intronic
1101497638 12:105270515-105270537 TAGGAAGGTGAGAAGGAGGAAGG + Intronic
1102339779 12:112112507-112112529 TAGGACAGGGAAAAGGAGGGAGG + Intergenic
1102959860 12:117085414-117085436 TCGGGAAGGCAGAAGGTGGAAGG + Intronic
1103195785 12:119042674-119042696 AAGGGCAGGAAGAGGGAGGAAGG + Intronic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103283729 12:119782880-119782902 TAGGACAGGTAGATGGTGGCAGG - Intronic
1103367028 12:120390820-120390842 AAGGAAAGGAAGAGGGAGGAAGG + Intergenic
1103898741 12:124292265-124292287 TAGGAAGGGCAGAGGGAAGAAGG - Intronic
1103899388 12:124295460-124295482 GAGGACAGCCTGAAGGAGCAGGG + Intronic
1103936377 12:124479746-124479768 GATGCCAGGCAGAGGGAGGAGGG + Intronic
1103955871 12:124576519-124576541 TCGGACAGGCAGAAGCCAGAGGG - Intergenic
1104035520 12:125094668-125094690 GAGAGCAGGCAGAAGGAGGTGGG - Intronic
1104622711 12:130330429-130330451 TCGGACAGGCCGATGGAGGGGGG + Intergenic
1104814476 12:131637830-131637852 TGGGGCAGTCAGAGGGAGGAGGG + Intergenic
1105623454 13:22090746-22090768 TAGGAAAGTCAGACGCAGGATGG + Intergenic
1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG + Intronic
1106015747 13:25867566-25867588 TAGGAAAGGGTGAAGGAGGATGG - Intronic
1106042063 13:26103094-26103116 GAGGGCAAGCAGAAGCAGGATGG + Intergenic
1106135034 13:26967551-26967573 TGGGATAGGGGGAAGGAGGAGGG + Intergenic
1106391506 13:29339227-29339249 TAGGGCAGGCAGCAGGCTGAGGG + Intronic
1107181791 13:37469847-37469869 CAAGGCAGGCAGAAGAAGGAGGG + Intergenic
1107376466 13:39809984-39810006 TCGAAGAGGAAGAAGGAGGAGGG - Intergenic
1107438899 13:40406459-40406481 TGGCACAGGAAGAAGGAGGGTGG + Intergenic
1108084352 13:46769673-46769695 AGGGACAGGCACAAGCAGGACGG - Intergenic
1108192750 13:47959409-47959431 AGGGAGAGGGAGAAGGAGGAGGG + Intronic
1108274018 13:48789764-48789786 GAGGGCAGGAAGAAGGAGGAAGG + Intergenic
1108593950 13:51934677-51934699 CAGGACAGCCAGCAGCAGGATGG - Exonic
1110232052 13:73177395-73177417 TAGCTCAGTCAGTAGGAGGATGG + Intergenic
1111681967 13:91453788-91453810 AAAGAAAGGAAGAAGGAGGAGGG - Intronic
1112713744 13:102160081-102160103 TAGGAGAGTGAGATGGAGGAAGG - Intronic
1112987293 13:105466649-105466671 TAGCACAGGCAGATGGAGTGAGG - Intronic
1113088419 13:106592236-106592258 TAGGCCAAGGAGGAGGAGGAGGG - Intergenic
1113098738 13:106694566-106694588 CTGCACAGGCAGAAGAAGGAAGG - Intergenic
1113427423 13:110220675-110220697 AATGATAGTCAGAAGGAGGACGG - Intronic
1113554065 13:111216894-111216916 TCTGAAAGGCAGAAAGAGGAAGG - Intronic
1113613296 13:111663323-111663345 AAGGTGAGGAAGAAGGAGGAGGG - Intronic
1113754784 13:112803828-112803850 AAGGAGAGGAAGGAGGAGGAGGG - Intronic
1113803810 13:113101807-113101829 GAGCAGAGGCAGGAGGAGGAGGG + Intergenic
1113967829 13:114164392-114164414 AAGGAGAGGCAGATGGGGGAAGG + Intergenic
1114150319 14:20031272-20031294 AATGGCAGGCAGAAGGAGGGCGG + Intergenic
1114595213 14:23906264-23906286 TGGGATAGGCAGAAGGAGATAGG - Intergenic
1114871791 14:26667155-26667177 TAGGAAGACCAGAAGGAGGAAGG - Intergenic
1114895870 14:26990618-26990640 TAGAATAGGGAGAAGAAGGAAGG + Intergenic
1114934449 14:27515833-27515855 TGGGTCAGGCACAAGGATGACGG + Intergenic
1115217363 14:31026367-31026389 TGAGACGGGCAGATGGAGGAGGG - Exonic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1116073437 14:40080018-40080040 TAGGAGAGTGAGAAAGAGGAGGG - Intergenic
1116416968 14:44689811-44689833 GAGGAGGGGCAGGAGGAGGAGGG + Intergenic
1116416974 14:44689826-44689848 GAGGAGGGGCAGGAGGAGGAGGG + Intergenic
1116416980 14:44689841-44689863 GAGGAGGGGCAGGAGGAGGAGGG + Intergenic
1117094343 14:52282300-52282322 TAGAACATGCAGGAGAAGGAGGG - Intergenic
1118806806 14:69245046-69245068 TGGGACAGGCAGAAGGTGCTGGG - Intergenic
1119117920 14:72044491-72044513 AAGGAGAGGGAGAGGGAGGAAGG - Intronic
1119147200 14:72328129-72328151 TAGAACAAAAAGAAGGAGGAGGG - Intronic
1119615420 14:76095804-76095826 AAGGACAGACAGTAGGAGGGTGG - Intergenic
1120219408 14:81715291-81715313 GAGGACAGGAAGCAGGAGTAAGG - Intergenic
1120255767 14:82117484-82117506 TATGAGAGGGAGATGGAGGAAGG + Intergenic
1120617341 14:86723619-86723641 AAGGAAAGGCAGTGGGAGGATGG + Intergenic
1120964956 14:90158832-90158854 TGGGACAGGCCGTAAGAGGAAGG + Intronic
1121338440 14:93091069-93091091 AAGGAAAGGCAGGAAGAGGAAGG + Intronic
1121845506 14:97169032-97169054 GAGGACAGGCAGCAGAAGGAGGG - Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1121960231 14:98252964-98252986 TGGGACAGAGAGAAGCAGGAGGG + Intergenic
1202936348 14_KI270725v1_random:91540-91562 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1124841108 15:33243048-33243070 TAGGCCTGGAGGAAGGAGGATGG - Intergenic
1125003891 15:34796813-34796835 GAGGAGAGGGAGAAGGAAGAGGG + Intergenic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1126129302 15:45325021-45325043 TAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1126145012 15:45465903-45465925 CAAAACAGGCAGAAGAAGGAGGG + Intergenic
1126335809 15:47585027-47585049 TAAGATAGGCAGAAAGACGATGG - Intronic
1127392954 15:58521662-58521684 TAGGAGGGGAAGAAAGAGGAAGG + Intronic
1127704960 15:61537355-61537377 TAGGTCAGGGAGGATGAGGATGG + Intergenic
1127797708 15:62452792-62452814 AAGGACAGGCAGAAGGGAGCAGG - Intronic
1128115514 15:65102479-65102501 CAGGAGAGGCCGGAGGAGGAGGG - Exonic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1129239245 15:74241923-74241945 TGGGGCAGACAGCAGGAGGAGGG + Intronic
1129351514 15:74958359-74958381 TAGGGCGGGTGGAAGGAGGACGG - Intronic
1129885860 15:79036527-79036549 TAAGACAGTGAGATGGAGGAGGG - Intronic
1130531414 15:84749572-84749594 TAGGACTGGCAGTAGAAGAATGG + Intronic
1130927481 15:88396426-88396448 AAGGAAGGGGAGAAGGAGGAGGG - Intergenic
1131014142 15:89043472-89043494 AAGGAGAGGAAGAAGGGGGAGGG + Intergenic
1131059490 15:89395862-89395884 TAGGAGGGGGAGAAAGAGGAGGG - Intergenic
1131426438 15:92348924-92348946 TCAGACAGGCAGAAGCAGGTGGG - Intergenic
1131513194 15:93060894-93060916 TAGGAAAGGCTGAAGTAGGGCGG + Intronic
1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG + Intergenic
1132028069 15:98419644-98419666 GAGGAGAGGGAGGAGGAGGAGGG + Intergenic
1132121767 15:99182140-99182162 TAAGGCAGGTAGAAGGGGGAAGG - Intronic
1132318148 15:100905412-100905434 AAGAACATGCAGAGGGAGGATGG + Intronic
1132431651 15:101766182-101766204 AAGGAGAGGAAGAAGGAGGGAGG - Intergenic
1132530256 16:444333-444355 TAAGGCAGGCAGCAGCAGGACGG + Intronic
1132612726 16:825293-825315 TCGGAGAGGGACAAGGAGGAAGG - Intergenic
1132833478 16:1941171-1941193 TGGGGCAAGCAGAGGGAGGAAGG + Intronic
1132989754 16:2786679-2786701 GAGGACAGACAGAAGGACCACGG - Exonic
1133000532 16:2849160-2849182 CAGGACTAGAAGAAGGAGGAAGG + Intergenic
1133485421 16:6214732-6214754 AAGGAGAGGGAGAAGGAGAAGGG + Intronic
1134197544 16:12170524-12170546 AAGCTCAGGCAGAAGGAGGAGGG + Intronic
1135170434 16:20178908-20178930 AAAGACAAGAAGAAGGAGGAGGG - Intergenic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135694706 16:24575793-24575815 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135694758 16:24575915-24575937 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135739102 16:24958007-24958029 AAGGACAGGCAGAGGTGGGAGGG + Intronic
1135848367 16:25939798-25939820 TAGGGCAGCCAGAATGAGGAAGG + Intronic
1135965804 16:27034064-27034086 ATGCACAGGCAGAAGGAGAAAGG + Intergenic
1136405083 16:30040601-30040623 TAGGAGAGGCAGAAGGAGTGAGG + Intronic
1137290438 16:47048867-47048889 GAGGCCAGGCAGCAGCAGGAAGG + Intergenic
1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG + Intronic
1138277436 16:55746035-55746057 GAGGGCAGGCAGAAGGAGAGAGG + Intergenic
1138333285 16:56232162-56232184 TAGGAGAGGCTGCAGGAGGGAGG - Intronic
1138530830 16:57633516-57633538 TAGGAGAGGCAGCACGAGGTGGG + Intronic
1138554387 16:57763331-57763353 CAGGCCAGGCAGGAGGAGGAAGG - Intronic
1139458200 16:67100781-67100803 TAAGACAGACAGAAGCAGCATGG - Exonic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1139802589 16:69535620-69535642 TAGGATAGAGGGAAGGAGGAGGG + Intergenic
1140376116 16:74446665-74446687 TAGAGGAGGAAGAAGGAGGAGGG - Intergenic
1141127920 16:81414388-81414410 GAGACCAGGCAGAAGGAGGTTGG - Intergenic
1141141657 16:81500382-81500404 AAGGAGAGAGAGAAGGAGGAAGG - Intronic
1141514578 16:84535154-84535176 GAGGAGTGGGAGAAGGAGGAGGG - Intronic
1141775773 16:86121797-86121819 AGGGACAAGCAGGAGGAGGAAGG - Intergenic
1141775807 16:86121912-86121934 AGGGACAGGGAGGAGGAGGATGG - Intergenic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1141845220 16:86603891-86603913 AAGGAAAGGAAGGAGGAGGAGGG - Intergenic
1141846229 16:86610874-86610896 TGGGACAGGCTGCAGGAGCACGG + Intergenic
1142597653 17:1037331-1037353 GAGGTCAGGCAGAGGGAGGCTGG - Intronic
1142599589 17:1047144-1047166 TAGGAAAGGCAGGAGGAGGAGGG - Intronic
1142980303 17:3667771-3667793 TAGACTAGGCAGAGGGAGGAAGG - Intronic
1143085496 17:4413079-4413101 CAGGGCAGGAGGAAGGAGGACGG - Intergenic
1143374428 17:6458902-6458924 AAGGACAGGAAGAAGATGGAAGG - Intronic
1143512988 17:7405979-7406001 AGGGATAGGGAGAAGGAGGAGGG + Intronic
1143591008 17:7885680-7885702 TTGGACAGGCAGAGTGGGGACGG + Intronic
1144668917 17:17120465-17120487 GAGGACCGGCAGGAGGAGCAGGG + Intronic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1145965529 17:28914043-28914065 CAGGATAGATAGAAGGAGGAAGG + Intronic
1145973850 17:28972890-28972912 GAGCACTGGGAGAAGGAGGAAGG + Intronic
1146127931 17:30243687-30243709 TGGCAGAGGCAGTAGGAGGAGGG + Intergenic
1146464922 17:33078901-33078923 TAGGACAGGAAGAAGGCTCAAGG + Intronic
1146809580 17:35892466-35892488 AAGGACAGCCAGAAGGGAGAAGG - Intergenic
1146908635 17:36633644-36633666 GAGGAAGGGGAGAAGGAGGAGGG + Intergenic
1147122573 17:38344175-38344197 AAGGGCAGGCAGAGGGAGGGAGG - Intergenic
1147493020 17:40888694-40888716 TCAGACAGGGAGAAGGAGGGTGG + Intergenic
1147596904 17:41723465-41723487 TTGGCCAGGCAGCAGAAGGAGGG + Exonic
1147606316 17:41775739-41775761 AAGGACAGGAAGAAGGAAGACGG + Intronic
1147657564 17:42099227-42099249 TGGGACAGGAGGGAGGAGGAAGG + Intergenic
1147961159 17:44168438-44168460 CAGGACAGGCAGCGGGAGAAGGG + Intergenic
1148177503 17:45580018-45580040 AAGGACAGGCAGATTGAGGGAGG - Intergenic
1148249594 17:46064625-46064647 TTGGAGAGGGAGGAGGAGGAGGG - Intronic
1148694223 17:49549421-49549443 CAGGGCAGGCAGAGGGAGAAAGG + Intergenic
1149107083 17:52982591-52982613 GAGGAGGGGGAGAAGGAGGAAGG - Intergenic
1149787094 17:59444871-59444893 TAGGTCAGGAAGAAGAGGGAAGG - Intergenic
1150000694 17:61437134-61437156 AAGGAGAGGGAGAGGGAGGAAGG - Intergenic
1150139581 17:62716889-62716911 AAGGACAAGCAGCAGGAGGGTGG + Intronic
1150645689 17:66976317-66976339 GAGGAAAGACAGAGGGAGGAGGG - Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1150868099 17:68875866-68875888 TAGGGCAGGTAGGATGAGGAAGG + Intronic
1151418320 17:73981246-73981268 TAAGAAACACAGAAGGAGGAAGG + Intergenic
1151470258 17:74313654-74313676 TGTGGCAGGCAGGAGGAGGAAGG - Intronic
1151472729 17:74327921-74327943 GAGGACAGGCAGATGGGGGTGGG + Intronic
1151509492 17:74549597-74549619 ACAGACAGGCAGAAGGTGGAGGG - Intergenic
1151635805 17:75347084-75347106 TACGACAGGGAGAAGGAAGGGGG - Intronic
1151678700 17:75613170-75613192 TAGGACAGGCAGTGGGGGAAAGG - Intergenic
1152328044 17:79653669-79653691 AAGAATAGGCAGAAGTAGGAAGG + Intergenic
1153359879 18:4182231-4182253 AAGAACAAGCAGAAGCAGGAAGG + Intronic
1153365092 18:4247072-4247094 TAGGACAAGGAGGAGAAGGAAGG + Intronic
1153448213 18:5197091-5197113 AAAGACAGGCAGACGGAGGATGG + Exonic
1153503479 18:5771478-5771500 TAGGACAGGCAGACTCAGGCAGG - Intergenic
1153987778 18:10368551-10368573 GAGGAGAGGGAGAGGGAGGAAGG + Intergenic
1155402780 18:25457370-25457392 AATGACATGCAGAAGGAGCAGGG + Intergenic
1155759054 18:29541369-29541391 GAGGAGAGGGAGAAAGAGGAAGG - Intergenic
1155857432 18:30850569-30850591 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1157323951 18:46655948-46655970 GAGGACAGGAAGAGGGAGAAAGG + Intronic
1157433169 18:47646921-47646943 CAGGAAAGGCAGGAGGAAGAAGG - Intergenic
1157762577 18:50275333-50275355 TGGGACAGGCAGACAGAGGGTGG + Intronic
1159258663 18:65981194-65981216 AAGGAAAGGCAGAAAGAGAAAGG - Intergenic
1160225694 18:77009201-77009223 GAGGACAGCCAGGAGGAGAAGGG - Intronic
1160262692 18:77309885-77309907 TAAAACAGGCAGAAGAAGGTGGG + Intergenic
1160597017 18:79982758-79982780 TAGGAGAGGCTGAAAGAGGCAGG + Intronic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1161347907 19:3777290-3777312 TGGGGGAGGCAGGAGGAGGAGGG + Intergenic
1161861601 19:6802024-6802046 TAGGAGAGGCATTATGAGGACGG - Intronic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162053096 19:8046815-8046837 GAGGAGGGGGAGAAGGAGGAGGG - Intronic
1162176797 19:8836386-8836408 GAGGACAAGGAGGAGGAGGAAGG - Intronic
1163122021 19:15223833-15223855 GAAGACGGGCAGGAGGAGGAGGG - Intergenic
1163127280 19:15251157-15251179 GAACACAGGCAGGAGGAGGATGG - Intronic
1163781252 19:19249876-19249898 GAGGACTGGGAGAAGGACGAAGG + Exonic
1164649906 19:29884233-29884255 AAGGAAAGGAAGAAGGAAGAAGG - Intergenic
1165580002 19:36854259-36854281 AAGGACAGGCAGGAGGAGATAGG - Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166348431 19:42181447-42181469 ATGAACAGGCAGAATGAGGAGGG - Intronic
1167049365 19:47069091-47069113 CAGGACCGGGAGAATGAGGAAGG - Exonic
1167104466 19:47421992-47422014 TGGGCCAGGCAGCGGGAGGACGG - Intergenic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167608258 19:50493209-50493231 GAGGAGAGGTAGAAGGAGAATGG + Intergenic
1202684201 1_KI270712v1_random:33952-33974 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
925053314 2:834228-834250 TAGAACAGGGAGAAGGGAGAAGG + Intergenic
925402563 2:3586022-3586044 GAGGAGAGGAAAAAGGAGGAGGG + Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925773435 2:7307285-7307307 TAGAACACAAAGAAGGAGGAAGG + Intergenic
926094084 2:10069870-10069892 TGGGACAGGCAGAAGAAGTGTGG - Intronic
926457165 2:13081045-13081067 TAGGATTGGCAGAAAGAGTATGG - Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926723849 2:15982548-15982570 GAGGACAGGCAGAAGGATCCAGG + Intergenic
926903045 2:17777456-17777478 TAATACAGGCAGAAGGAAGATGG + Intronic
927049808 2:19316193-19316215 TTGGAGAGTCAGAGGGAGGAGGG - Intergenic
927413871 2:22856339-22856361 TAGGCCACACAGGAGGAGGAAGG + Intergenic
927946669 2:27138856-27138878 GAGGAGAGGAATAAGGAGGAAGG + Intronic
927992775 2:27459890-27459912 TAGGACAGGGAGATGAAGCATGG + Intronic
928078149 2:28284236-28284258 TGGGACAGGCAGCAGGGGAATGG - Intronic
928316815 2:30252813-30252835 CAGGGCTGGCAGAGGGAGGAAGG + Intronic
928692745 2:33817577-33817599 TAGGACAGTATCAAGGAGGATGG + Intergenic
928924673 2:36565573-36565595 GAGGTCAGGTAGAAGGAGGAGGG - Intronic
930223386 2:48767867-48767889 GAGGGCAGGCAGAAGCAGGGTGG - Intronic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
931285766 2:60830338-60830360 CATGCCAGGCAGAAGGAGGAAGG + Intergenic
931317627 2:61147472-61147494 GAGGACATGCAGCAAGAGGAAGG - Intronic
931376578 2:61713495-61713517 TCGAAAAGGCAGGAGGAGGAAGG + Intergenic
931671833 2:64654175-64654197 AAGGACGGGCTGAAAGAGGAGGG + Intronic
931926052 2:67073734-67073756 TTGGGCAGGTGGAAGGAGGAAGG - Intergenic
932591071 2:73068083-73068105 GAGGACGGGCAGAAAGAGGGTGG - Intronic
932597390 2:73102515-73102537 TAGGACAGGAACAATGGGGAAGG + Intronic
933275881 2:80283881-80283903 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
933299239 2:80523947-80523969 TAGGATAGGCAGAGGTAGAAGGG + Intronic
933409886 2:81911744-81911766 GAGGAAAGGAAGAAAGAGGAGGG - Intergenic
933614665 2:84471423-84471445 TAGGAGTTGCAGAAGGATGAAGG + Intergenic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
934123039 2:88858210-88858232 TGGAACAGTCAGAAGGTGGAGGG - Intergenic
934247518 2:90320900-90320922 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
934261806 2:91481701-91481723 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
934304846 2:91812680-91812702 TAGGACAGCCCGAAGGAGGGGGG - Intergenic
934328411 2:92040070-92040092 TAGGACAGCCCGAAGGAGGGGGG + Intergenic
935098579 2:99970673-99970695 TAGGAAAGGGAGGAGAAGGAGGG - Intronic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935265754 2:101392453-101392475 AATGACACACAGAAGGAGGAAGG + Intergenic
935383581 2:102478583-102478605 TAGGAAAGCAGGAAGGAGGATGG + Intronic
935855343 2:107267338-107267360 TAGGAGAGATAGAAGGGGGAAGG + Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936530265 2:113271421-113271443 TTGGAAAGGCAGAGGGAGGGAGG - Intronic
936816055 2:116462268-116462290 TTGGAAAGGCAGGGGGAGGAGGG + Intergenic
937062779 2:118992696-118992718 AAGGAAAGGAAGAAGGAGAAAGG - Intronic
937323665 2:120975991-120976013 GGGAACAGGCAGGAGGAGGAAGG - Intronic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937422494 2:121769987-121770009 TAGGGCTGGCAGTAGGAGCAGGG - Intergenic
938773146 2:134518443-134518465 TAGGACAGGCAGGATGATAATGG - Intronic
939640930 2:144638977-144638999 TAGGGCAAGCAGAAGCAGGGTGG - Intergenic
940007938 2:149026166-149026188 TGGGAAAGGCAGAGGGTGGAGGG + Exonic
940088964 2:149895129-149895151 CCGGAAAGGCATAAGGAGGAAGG - Intergenic
940982083 2:160014902-160014924 AAGGACAGGGAGAGGGAGGCTGG + Intronic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
942551971 2:177129223-177129245 TATGACAGACCAAAGGAGGAGGG + Intergenic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
942764003 2:179432432-179432454 TAGGAGAGGTACAAGGAGGCTGG - Intergenic
943024878 2:182615796-182615818 AAGGAGAGGGAGAAGGAAGAGGG + Intergenic
943675909 2:190716337-190716359 TAGGACAGGGAGAAGGGAAAAGG + Intergenic
944058617 2:195548305-195548327 AAGGAAAGGAAGAAGGAAGAGGG + Intergenic
944143113 2:196478276-196478298 TTGGACAGGCAGAAAGGAGAAGG + Intronic
944850445 2:203713943-203713965 TAGGAAAGAAAGGAGGAGGAGGG + Intronic
946220627 2:218222990-218223012 TAGGGCAGGCAGCAGGTGGCAGG - Intronic
946394123 2:219434842-219434864 TAGCACAGGCCGAAGGCGGGCGG + Exonic
946838382 2:223795578-223795600 TAGGCCAGGCAGAAGGGGCCAGG + Intronic
946883802 2:224202816-224202838 TACAACAGGTAGGAGGAGGAGGG + Intergenic
947377733 2:229513884-229513906 GAGGACAGGGAGAGGGAGGGAGG - Intronic
947489276 2:230579825-230579847 TAGCACACACAGAAGGGGGAAGG - Intergenic
947650543 2:231782493-231782515 GGGGACAGGCAGAGGAAGGAAGG - Intronic
947821747 2:233076421-233076443 TAGGACAGGGAGCAGAAGGATGG + Intronic
947874195 2:233457718-233457740 CAGGGCAGGCACATGGAGGATGG + Intronic
947927659 2:233935776-233935798 TGGGGCAGGCAGAAGGAAGCTGG + Intronic
947952733 2:234161942-234161964 GAGCACAGGCTGAGGGAGGAGGG - Intergenic
948085497 2:235243388-235243410 TTGAACAGGCAGAAGGACTAAGG + Intergenic
948318762 2:237052309-237052331 TTTGACAGGCTGAAGGAAGAAGG + Intergenic
948428354 2:237902408-237902430 AAGGACAGGGAGATGGAGGAGGG + Intronic
948612117 2:239176374-239176396 AAGGCCAGGCAGAGGGAGGGAGG - Intronic
1168866739 20:1093001-1093023 TAGGGCAGGAAGGTGGAGGAAGG + Intergenic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169244774 20:4016584-4016606 CAGGAGGGGCAGATGGAGGAGGG - Intergenic
1169404295 20:5310591-5310613 TAGGATAGGGAGAAAGAGTAAGG - Intronic
1170451583 20:16489249-16489271 TAGGCGAGGCTGAAGGGGGAGGG + Intronic
1170872066 20:20214877-20214899 CAGGGCAGGCAGAAGGAGAGTGG + Intronic
1171029365 20:21663419-21663441 TAGGGTAGGGAGAACGAGGAGGG + Intergenic
1171300193 20:24053095-24053117 CAGGACAGGCAGACTGGGGAGGG - Intergenic
1171491757 20:25524419-25524441 TGGGACAGACGGAAGGACGATGG + Intronic
1172038690 20:32028773-32028795 TAGTAGAGGAAGAAGGAGAAGGG + Intronic
1172183400 20:33017013-33017035 TAAGACAGAGAGAAGGAGGCTGG - Intronic
1172239799 20:33405254-33405276 TAGGACAGGAAGACAGAGCAAGG + Intergenic
1172344839 20:34189944-34189966 TAGGACATGCAGAGGCAGGCAGG + Intergenic
1173112405 20:40204604-40204626 AAAGAAAGGAAGAAGGAGGAAGG - Intergenic
1173174861 20:40756806-40756828 GGGGACAGGCAAATGGAGGAAGG - Intergenic
1173189531 20:40865415-40865437 TAGAACAGGCAGGATGGGGATGG - Intergenic
1173313060 20:41917655-41917677 AAGGAGAGGCAGAGGGAGAAGGG + Intergenic
1173452838 20:43180388-43180410 TATGACAGGGAGAGAGAGGAAGG - Intronic
1174288397 20:49488860-49488882 TAGAGCAGGCAGAAGAAGGTGGG + Intergenic
1174540842 20:51288199-51288221 TAAGACAGGCAGTACCAGGAAGG + Intergenic
1174554003 20:51381157-51381179 GAGGACAGGCAGAAGGGGAAAGG + Intergenic
1174604417 20:51750613-51750635 TAGGACAGTCGGGAGGAGCAAGG - Intronic
1175315004 20:58040979-58041001 TTAGCCCGGCAGAAGGAGGATGG - Intergenic
1175423354 20:58849852-58849874 TAGGAAAAGCAGAAGCAGCATGG - Intronic
1175665230 20:60852946-60852968 TAGGCCAAGAAGAGGGAGGAGGG + Intergenic
1175813334 20:61870512-61870534 AGGGACATGCAGAAGGTGGAGGG - Intronic
1176587149 21:8598059-8598081 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
1177521857 21:22237043-22237065 TAGAACAGAAAGAAGGAAGAAGG + Intergenic
1177530002 21:22346248-22346270 TAGGACTGGCTTAAGGAGGAGGG + Intergenic
1178348499 21:31852392-31852414 TAGGCCGGTCTGAAGGAGGAAGG - Intergenic
1178373808 21:32050075-32050097 AATGACAGGCAGAAGGTAGACGG + Intergenic
1178598317 21:33974660-33974682 AAGGAAAGGAAGAAGGGGGATGG - Intergenic
1179125073 21:38583265-38583287 TGGGGCAGGAAGAAGGAGGCAGG + Intronic
1179146741 21:38774755-38774777 TGGTACAGGCAGGGGGAGGATGG + Intergenic
1179337922 21:40475113-40475135 CACGACAGTCTGAAGGAGGAGGG - Intronic
1180058994 21:45375129-45375151 AAGGACAGACAGAAAGAGGTCGG + Intergenic
1180269980 22:10575056-10575078 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
1180587927 22:16909807-16909829 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1180898129 22:19352184-19352206 TAGAACAGGCAGGTGGAAGATGG + Intronic
1180898264 22:19353114-19353136 CAGGACAGGCAGCAGGACGGAGG - Intronic
1180990108 22:19930588-19930610 AAGGACAGGGACAAGCAGGAGGG + Intronic
1181116377 22:20634696-20634718 GGAGACAGGCAGAAGCAGGAGGG + Intergenic
1181317088 22:21977957-21977979 GAGTCCAGGCAGAAGGAGCAGGG + Intronic
1181408709 22:22703214-22703236 AAGGAAAGGCAGAGGCAGGAGGG - Intergenic
1181413982 22:22746343-22746365 AAGGAAAGGCAGAGGGAGGAGGG - Intronic
1181419628 22:22788866-22788888 AAGGAAAGGCAGAGGGAGAAGGG - Intronic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181671198 22:24426331-24426353 AAGGACAGACAGAAGATGGATGG + Intronic
1181704968 22:24644489-24644511 TGGGAGGGGCAGAGGGAGGAGGG + Intergenic
1182048511 22:27295766-27295788 TAGGAGAGAGGGAAGGAGGAAGG + Intergenic
1182151250 22:28028614-28028636 TAGGAAGGGAAGAAGGATGAGGG + Intronic
1182164738 22:28161848-28161870 TAAGAAAGGAAGAAAGAGGAAGG + Intronic
1182848080 22:33447766-33447788 CAGCACAGGGAGGAGGAGGAAGG + Intronic
1183050596 22:35257749-35257771 TGGAGCGGGCAGAAGGAGGAGGG + Intronic
1183259929 22:36788127-36788149 TGAGAGAGGGAGAAGGAGGAAGG + Intergenic
1183404842 22:37625295-37625317 GAGGACAGGCAGAAGAAGGAAGG + Intronic
1184610342 22:45599273-45599295 CAGGGCAGTCAAAAGGAGGATGG - Intronic
1185277323 22:49955394-49955416 CAGGACAGGAAGAATGAGGTGGG + Intergenic
949097380 3:101404-101426 TAGGACAGGGTGAAGGTGAATGG - Intergenic
950436179 3:12981769-12981791 GGGGACAGGCAGCAGGAGGCGGG - Intronic
950540125 3:13607428-13607450 TAGGAGGGGGAGGAGGAGGAGGG + Intronic
950829439 3:15859682-15859704 TAGGGCAGGCAGCAGAGGGAAGG - Exonic
951881178 3:27483380-27483402 CAGGCCAAGTAGAAGGAGGAGGG - Intronic
952141752 3:30487077-30487099 TAAGACAGAGAGTAGGAGGAAGG - Intergenic
952923963 3:38307924-38307946 TTGGACAGGCAGAAGTGGAAGGG + Intronic
953430498 3:42835882-42835904 TCGGGTGGGCAGAAGGAGGAAGG - Intronic
954287781 3:49631012-49631034 AAGGACAGGAAGAAGGGAGAGGG - Intronic
954389833 3:50262892-50262914 GAGGACAGGCACAGGGAGGCGGG - Intergenic
954450939 3:50571353-50571375 GAGGACAGGAAGAGGGAGGAGGG + Intronic
954524862 3:51261260-51261282 GAGGGCAAGCAGAAGGAGGGTGG + Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955819557 3:62881715-62881737 CAGCAGAGGCAGAAGCAGGAAGG - Intergenic
956147837 3:66210116-66210138 TAGAAAAGGGAGAAGGAGGGAGG - Intronic
956230788 3:67014155-67014177 TGGCACAGCCAGAAAGAGGATGG - Intergenic
956324854 3:68040690-68040712 TAGGTCTGGCAGAAGGAGGAAGG - Intronic
956972051 3:74537640-74537662 TAGGGAAGGCAGAGGAAGGATGG + Intergenic
957928568 3:86847283-86847305 CAGGAAAGGGAGAAGGAAGAGGG - Intergenic
958114345 3:89196026-89196048 AATGACTGGGAGAAGGAGGAAGG - Intronic
958455478 3:94325913-94325935 CAAGGCAGGAAGAAGGAGGAAGG + Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959539903 3:107525327-107525349 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
959595985 3:108128899-108128921 AAGGAGAGGCAGAAGGAAGCAGG + Intergenic
959833662 3:110893272-110893294 AAGGACAAAAAGAAGGAGGAAGG - Exonic
959912542 3:111779806-111779828 TAGCAAAGGCAAAAAGAGGATGG - Intronic
959946983 3:112135398-112135420 TAAAACAGGCAGGAGAAGGATGG + Intergenic
960198179 3:114796728-114796750 TAGGATAGTCAAAAGCAGGATGG + Intronic
961030581 3:123600054-123600076 TAGGAAGGGGAGGAGGAGGAAGG - Intergenic
961745152 3:129059760-129059782 TTGGCCATGCAGGAGGAGGAAGG + Intergenic
962491363 3:135897002-135897024 GAGGAAAGGGAGAGGGAGGAAGG - Intergenic
962959147 3:140293878-140293900 TAGGAAAGGTGGAAGGAGGATGG - Intronic
963057929 3:141202389-141202411 TAGGACATGCAGGAGGAGGAAGG + Intergenic
963116575 3:141735424-141735446 AAGGAAAGGGAGAAGGAGAAAGG - Intergenic
963928745 3:150979406-150979428 TAGGAAAGTAAAAAGGAGGAAGG - Intergenic
964168674 3:153739813-153739835 AACGACAGGAAGAATGAGGAGGG + Intergenic
964274413 3:154993910-154993932 GAGGACAGGTAGAGGAAGGAAGG + Intergenic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
965766945 3:172140814-172140836 TGAGACAGGAAGAAGGAGAAAGG - Intronic
966396327 3:179507405-179507427 AAGGAAGGGAAGAAGGAGGAAGG + Intergenic
966908531 3:184544637-184544659 TAGGAGGGGGAGGAGGAGGAGGG - Intronic
967068057 3:185938091-185938113 GAGGAAAGGCAGAGCGAGGAGGG - Exonic
967094581 3:186166658-186166680 AAAGACAGAGAGAAGGAGGAGGG + Intronic
967612842 3:191528244-191528266 TAGAACAGAAAGATGGAGGAAGG + Intergenic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
967907371 3:194512895-194512917 TAGCACAGCCTGAAGGAGAATGG - Intergenic
968126380 3:196163584-196163606 AAGGACGGGTAGAAGGAAGAGGG - Intergenic
968628590 4:1638803-1638825 AAGGACAGGCAGGAGGAGGGGGG - Intronic
968785919 4:2622375-2622397 CAGGACAGGCATAAGGAAGCAGG - Intronic
968925454 4:3544886-3544908 GAGGCCAGGCAGAAGCAGCATGG + Intergenic
969232448 4:5841200-5841222 TCAGACAGGCAGCCGGAGGAGGG - Intronic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969323668 4:6428117-6428139 TAGGACATGCATAAAGAGGAAGG - Intronic
969455425 4:7297327-7297349 GAGGACAGGCAGAGGCAGAAGGG - Intronic
969532008 4:7735343-7735365 TGGGACCGGGAGCAGGAGGAGGG - Intronic
969939903 4:10721732-10721754 CAGGAGAGGGAGAAGGAGCACGG + Intergenic
970360139 4:15301034-15301056 TAGGACACACAGTATGAGGAAGG + Intergenic
971055921 4:22912372-22912394 AAGGACAGACAGAAAGTGGAAGG - Intergenic
971112356 4:23602552-23602574 AAGGAAAGGAAGAAGGAAGAAGG + Intergenic
971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG + Intergenic
971734245 4:30425641-30425663 AAGGACAGGAGGAAGGAAGAAGG + Intergenic
972324577 4:38003296-38003318 TAGGGCTGGCAGAAGGAAGGAGG + Intronic
972652191 4:41028908-41028930 TAGAAAAGGGAAAAGGAGGAGGG - Intronic
973529337 4:51819234-51819256 GGGGACAGCCAGAAGAAGGATGG + Intergenic
974103279 4:57440581-57440603 TAAAAAAGGTAGAAGGAGGAAGG - Intergenic
974122986 4:57662589-57662611 CAGGAGAGGGAGAAGGAGAAGGG + Intergenic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974323535 4:60385358-60385380 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
975759426 4:77604340-77604362 TGCGATAGACAGAAGGAGGAAGG - Intronic
976103629 4:81593047-81593069 AAGAACAAGCAGAAGGAGCAGGG + Intronic
976635111 4:87279564-87279586 GAGGAGAGGCAGAATGAGGCGGG + Intergenic
977292924 4:95182516-95182538 GAGGAGAGACAGATGGAGGATGG + Intronic
977830945 4:101592054-101592076 CAGGACAGGCAACAGGGGGAAGG - Intronic
978572786 4:110157121-110157143 AAGGCCAAGAAGAAGGAGGAGGG + Intronic
978992943 4:115108995-115109017 TAGGAAAGCAAGAAGGAAGAAGG + Intronic
979481094 4:121218593-121218615 AGGGACGGGGAGAAGGAGGAAGG - Intronic
979687252 4:123524506-123524528 GAGGAAAGGAAGAAAGAGGAAGG - Intergenic
979737705 4:124108014-124108036 TTAGAAAGGCATAAGGAGGAAGG - Intergenic
980113633 4:128658688-128658710 TAGAACAGGGAGAAGGAAAAGGG + Intergenic
981004956 4:139865419-139865441 TATGAAAGGCAAAAGAAGGATGG - Intronic
981131502 4:141162651-141162673 GAGGACAAGCAGAAGCAGGGTGG + Intronic
981504900 4:145488945-145488967 TTGCATAGGCAGAAGGAAGAGGG + Intronic
981570798 4:146148616-146148638 TGGGGCAGGCAGAGGGAGGGAGG + Intergenic
981925717 4:150137311-150137333 TGGTAAAGGCAGAAGCAGGAGGG + Intronic
982004235 4:151049249-151049271 TAGGAGAGCCAGAAGGAAGATGG + Intergenic
982109810 4:152043859-152043881 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
982172822 4:152678427-152678449 TAGAAGAGGTGGAAGGAGGATGG + Intronic
983122137 4:163899447-163899469 TAGGACACAAAGAAGTAGGAGGG - Intronic
983262222 4:165469759-165469781 TATGACAGGCAGTAGGCTGAGGG + Intronic
984030526 4:174598702-174598724 TACCACAGGCAGGAGGAGGGAGG - Intergenic
984702230 4:182825777-182825799 GGGGAAAGGGAGAAGGAGGAGGG - Intergenic
984847641 4:184121181-184121203 TAGAATAGGGAAAAGGAGGAGGG - Intronic
985487236 5:158510-158532 TGGGATGGGCAGAGGGAGGAGGG - Intronic
985487255 5:158552-158574 CAGGACGGGCAGAGGGAGGAGGG - Intronic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985985596 5:3513461-3513483 CGGGAGAGGCAGAAGGAGAAGGG + Intergenic
987067501 5:14303817-14303839 TAGGAAAGGCTTAAGGAGGCAGG - Intronic
988208949 5:28177614-28177636 TGGGAGAGGCATGAGGAGGAGGG - Intergenic
990317858 5:54601077-54601099 ATGGACAGACAGAGGGAGGACGG - Intergenic
990327719 5:54694609-54694631 CATTCCAGGCAGAAGGAGGAGGG + Intergenic
990517820 5:56546951-56546973 TAGGAGAGGCAAAGGGAAGAGGG - Intronic
990628046 5:57636328-57636350 TAGGATGGGCAGAAGGACGCAGG + Intergenic
991179183 5:63728931-63728953 TGAGACAGACAGAAGCAGGATGG + Intergenic
992093648 5:73340611-73340633 TGGGGGAGGCAGAAGGGGGATGG - Intergenic
992408527 5:76482521-76482543 TAGTACATACAGAAGGAAGAGGG + Intronic
992540585 5:77760379-77760401 AAGGAAAGGAAAAAGGAGGAAGG - Intronic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994307645 5:98226380-98226402 TAGGAAAGAAAGAAGAAGGAAGG + Intergenic
994311923 5:98282953-98282975 TAGGAAACACAGAAGGAAGAAGG - Intergenic
994397857 5:99240961-99240983 TAGGGAAGGGAGAATGAGGATGG + Intergenic
994869685 5:105331629-105331651 GAGGAGAGGGAGGAGGAGGAGGG + Intergenic
995441329 5:112195620-112195642 AAGGACAGTCAGAGGGAAGAAGG - Intronic
996118211 5:119642547-119642569 GAGGAGAGGCAGAAGGATGGAGG - Intergenic
996154384 5:120080002-120080024 CAGGAAAGGCACAATGAGGAGGG + Intergenic
996215056 5:120856195-120856217 TAGGGAAGCCAGAAGGGGGATGG - Intergenic
996371350 5:122756188-122756210 TAGGAAAGGGTGAAGGATGAAGG + Intergenic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996503391 5:124241690-124241712 TAGGACAGGCCTAATGAGGCAGG + Intergenic
996847908 5:127921038-127921060 AAGGAAAGGAGGAAGGAGGAAGG + Intergenic
997339171 5:133129240-133129262 TAGGACATGAAAAAGGAGAATGG - Intergenic
997584769 5:135037801-135037823 TAGATCAGGCAGAAAGAGGTAGG - Intronic
997628413 5:135347492-135347514 CAGGACAGGTAGAGGCAGGAGGG - Intronic
998153794 5:139772491-139772513 TGGGACAGGGAGAAGGAGAGGGG - Intergenic
998537732 5:142950216-142950238 CAGGACAGGCAGAAAGCTGAAGG + Intronic
998586017 5:143428482-143428504 TTGGAAAGGCAGAAGGAGTCAGG - Intronic
999068544 5:148717497-148717519 CAGGAGAGGCAGAAGGTGAAGGG - Intergenic
999331915 5:150679419-150679441 TAGGAATGGCAGAGGTAGGAAGG - Intergenic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
1000010112 5:157223132-157223154 GAGCAGAGGCAGAAGGAAGAGGG + Intronic
1000049278 5:157547999-157548021 TAGAACAGAGAGCAGGAGGAAGG - Intronic
1000302114 5:159965658-159965680 TGGCAGAGGAAGAAGGAGGAAGG + Intronic
1001152683 5:169245910-169245932 TAGGACTGGGAGTAGGATGATGG - Intronic
1001977309 5:176010428-176010450 CAGGACATGCAGCAGGAGTATGG - Intronic
1002240117 5:177833352-177833374 CAGGACATGCAGCAGGAGTATGG + Intergenic
1002352440 5:178592412-178592434 GAGCAGAGGCAGAAGGAAGAAGG + Intergenic
1002430727 5:179202424-179202446 TAGGAGATGGAGAAGGAAGAAGG - Intronic
1003031508 6:2605254-2605276 TAGGAAAGAGGGAAGGAGGAAGG + Intergenic
1003454480 6:6269027-6269049 AAGTAAAGGCAGAAGGAAGAAGG + Intronic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003482407 6:6545994-6546016 CAGGAAAGGCTGAGGGAGGAAGG - Intergenic
1003557650 6:7155200-7155222 CAGGGCAGGCAGATGGATGATGG - Intronic
1004131216 6:12921667-12921689 AGGGAAAGGAAGAAGGAGGAAGG + Intronic
1004973590 6:20939253-20939275 TAGTAAATGCAGCAGGAGGAAGG - Intronic
1005081924 6:21965306-21965328 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081929 6:21965321-21965343 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081934 6:21965336-21965358 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081939 6:21965351-21965373 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081944 6:21965366-21965388 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081949 6:21965381-21965403 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005450070 6:25963494-25963516 TAGGGAAGGCAGAAAGAAGATGG - Intronic
1005507131 6:26479241-26479263 TTGGACAGGCAGACGATGGAGGG - Intergenic
1007193444 6:40039237-40039259 TATGACAGGAAGCAGGGGGATGG + Intergenic
1007622069 6:43221369-43221391 GAGGCCTGGCAGAAGGAGGGGGG + Intronic
1009815987 6:68736118-68736140 CAGGAGAGGCTGAAGCAGGAGGG - Intronic
1009929078 6:70154875-70154897 TAAAGCAGGCAGAAGGTGGAAGG - Intronic
1010262438 6:73831923-73831945 TTGCACAGGCAGTAGTAGGAAGG - Intergenic
1011771285 6:90676225-90676247 TTGGGGAGGGAGAAGGAGGATGG + Intergenic
1012055068 6:94395752-94395774 AAGGAGAGGAGGAAGGAGGAGGG + Intergenic
1013342839 6:109232105-109232127 GAGGAGTGGCAGAAGGAAGAGGG - Intergenic
1014352255 6:120359877-120359899 TAGATCAAGCAGAAGAAGGATGG + Intergenic
1014505546 6:122249649-122249671 TAGGAAAGAAAGAAGGAAGATGG + Intergenic
1015027495 6:128554069-128554091 GAAGAGAGGGAGAAGGAGGATGG - Intergenic
1015806570 6:137115805-137115827 TACAACAGGCAGAGAGAGGAAGG - Intergenic
1016014368 6:139168571-139168593 CAGGACAGGTAGAAGCAGGAGGG - Intronic
1016451971 6:144192607-144192629 TAAGATAGACAGAAGGAGCAGGG - Intergenic
1016472920 6:144393701-144393723 TAGAACAGGCAGAAGGAGGTGGG + Intronic
1016646191 6:146411274-146411296 TAGGAAAGGAAGAAGGCTGATGG + Intronic
1016724638 6:147348360-147348382 GGGGACAGGGAGTAGGAGGAAGG - Intronic
1016898186 6:149074576-149074598 TAGGACATCGAAAAGGAGGATGG + Exonic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017687479 6:156928009-156928031 GAGGACAGTAAGGAGGAGGAAGG + Intronic
1017743521 6:157427172-157427194 GAGCACAGGAGGAAGGAGGAAGG + Intronic
1018190763 6:161307464-161307486 TAAAGCAGGCAGAAGGTGGAAGG - Intergenic
1018681622 6:166270196-166270218 GAGGACAGGAGGATGGAGGAGGG + Intergenic
1019013341 6:168860923-168860945 GAGGAGAGGGAGAAAGAGGAAGG + Intergenic
1019151738 6:170010972-170010994 AAGGACAGAGGGAAGGAGGAGGG + Intergenic
1019327620 7:446062-446084 AAGGAAAGGAAGAAGGAGGGAGG + Intergenic
1019330926 7:460436-460458 TGGGGCTGGCAGAAGGAGGCGGG + Intergenic
1019481768 7:1270231-1270253 GAGGACAGGCTGAGGGATGAGGG - Intergenic
1019494609 7:1331978-1332000 CAGGACATTCTGAAGGAGGAGGG + Intergenic
1019757379 7:2782802-2782824 AAGGTCAGGAGGAAGGAGGATGG - Intronic
1019842660 7:3463809-3463831 CAGGACAGGCCATAGGAGGAGGG + Intronic
1020011514 7:4808087-4808109 GAAGAGAGGAAGAAGGAGGAGGG - Intronic
1020252804 7:6483541-6483563 TGGGACGGGCGGGAGGAGGATGG - Intronic
1020350134 7:7210461-7210483 TAGGCCAGACAGAAGGGAGAAGG + Intronic
1020577823 7:9956620-9956642 TAGGAGAGGAAAAAGGTGGATGG + Intergenic
1020682959 7:11259303-11259325 AAGGACAGCCAGAAATAGGAAGG - Intergenic
1021287075 7:18793551-18793573 AAGGAAGGGCAGAAGGAAGAGGG + Intronic
1021616151 7:22505100-22505122 GAGAAGAGGAAGAAGGAGGAAGG + Intronic
1022243602 7:28535612-28535634 TAGGAGAGAAAGAGGGAGGAAGG + Intronic
1022574805 7:31487306-31487328 AAGGACAGGAGGAAGGAGGAAGG - Intergenic
1022636596 7:32142172-32142194 AAGAAAAGGCAGAAGGAGAAGGG + Intronic
1022896595 7:34756181-34756203 TAGGACAGGAAGTAGGGGGGCGG - Intronic
1022925942 7:35056316-35056338 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1023370212 7:39505585-39505607 TGAGCCAGGCAGAAGGAAGATGG - Intergenic
1023710443 7:42986896-42986918 CAGGATAGGAAGAAAGAGGAAGG + Intergenic
1023974938 7:45021730-45021752 TGAGACAGGGAGGAGGAGGAGGG + Intronic
1024058702 7:45682650-45682672 TAGGACGGCGAGAAGGAGGATGG - Intronic
1024724275 7:52175091-52175113 TATGACAGCTAGAAGCAGGAAGG + Intergenic
1024991784 7:55240435-55240457 AAGAAGAGGCAGAAGGAGAAAGG - Intronic
1025830600 7:65045888-65045910 AAGGAAAGGAAGAAGGAGGGTGG - Intergenic
1025913422 7:65846436-65846458 TAGGAATGGAGGAAGGAGGAAGG - Intergenic
1025917755 7:65879674-65879696 AAGGAAAGGAAGAAGGAGGGTGG - Intronic
1026133958 7:67643130-67643152 TAAAACAGGCAGAATCAGGAAGG - Intergenic
1026140308 7:67699943-67699965 TATGACAGGCTGCAGGAGGTAGG + Intergenic
1026523336 7:71134392-71134414 AGGGGCAGGGAGAAGGAGGATGG + Intronic
1026678351 7:72446940-72446962 GAGGAAAAGCAGAAGGGGGAAGG + Intronic
1026742250 7:72986186-72986208 CAGGAAAGGCAGATGGGGGAGGG - Intergenic
1026802098 7:73406606-73406628 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1027028374 7:74870925-74870947 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1027101485 7:75378892-75378914 CAGGAAAGGCAGATGGGGGAGGG + Intergenic
1027464935 7:78503593-78503615 AAGGAGGGGGAGAAGGAGGAGGG - Intronic
1027689811 7:81330317-81330339 TATGAGAGCCAGAAGCAGGAAGG + Intergenic
1028376320 7:90149235-90149257 GAGAAGAGGAAGAAGGAGGAAGG - Intergenic
1029239077 7:99145699-99145721 TAGGACAGGCACAAGGCTGCAGG - Intergenic
1029466394 7:100727884-100727906 TAGGCCCAGCAGAAGCAGGAGGG + Intergenic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1029823948 7:103171006-103171028 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1030522203 7:110611739-110611761 TAGGAGGGGCAGAAGGAAGAGGG + Intergenic
1031219441 7:118945920-118945942 TGGGAGAGGCAGAAGGGAGATGG - Intergenic
1031959171 7:127973476-127973498 TAGGAAGGGCACTAGGAGGAAGG + Intronic
1032419142 7:131764126-131764148 GGGAACAGGCAGAAGTAGGAGGG - Intergenic
1032817993 7:135496705-135496727 TAGGAGAGGTAAAAGGAAGATGG - Intronic
1033398318 7:140996593-140996615 TAGGAGAGACAGAAGGATGGAGG - Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1033954878 7:146834490-146834512 AAGGAAAGACAGATGGAGGATGG + Intronic
1034274509 7:149818127-149818149 AAGGACAGGCAGAAGGTGGTGGG + Intergenic
1034422079 7:150995672-150995694 TGGGACGGGGAGAGGGAGGAGGG - Intronic
1034422186 7:150995933-150995955 TGGGACGGGGAGAGGGAGGAAGG - Intronic
1034422198 7:150995965-150995987 TGGGACGGGGAGAGGGAGGAAGG - Intronic
1034422236 7:150996065-150996087 TGGGATGGGGAGAAGGAGGAGGG - Intronic
1034422264 7:150996131-150996153 TGGGATGGGGAGAAGGAGGAGGG - Intronic
1034422289 7:150996196-150996218 TGGGACGGGGAGAAGGAGGAAGG - Intronic
1034956192 7:155336826-155336848 TAGGACAGGCAGGGAGAGGGTGG - Intergenic
1035568750 8:658878-658900 AAGGAAAGGCAGAGGAAGGACGG - Intronic
1035768341 8:2126770-2126792 TAGGAGAGGCTGATGGAGGCTGG + Intronic
1037648310 8:20813852-20813874 TAGGACAGGAATATGGAGGATGG - Intergenic
1037692038 8:21190045-21190067 TAGAAAAGGCAGAATGAGGACGG + Intergenic
1037706510 8:21319985-21320007 TGGGACAGGCGTAAGGAGGGTGG - Intergenic
1037776887 8:21841374-21841396 GAGGACAGGCAGAAAGACGCAGG + Intergenic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1038689028 8:29744336-29744358 TAGGTCAGCCAGAAGGTGAATGG + Intergenic
1038694598 8:29795148-29795170 TAGAGGAGGAAGAAGGAGGATGG - Intergenic
1039489466 8:37936694-37936716 TGGTACAGGCAGAAGAAGGGAGG - Intronic
1039762164 8:40589712-40589734 AAGGAAAGGAAGAAGGAAGAAGG - Intronic
1039768377 8:40656264-40656286 TAGGATAGGCAGAATAAAGAAGG + Intronic
1040319836 8:46286959-46286981 TGGGACAGGCAGAGGGGAGAAGG - Intergenic
1040332293 8:46391780-46391802 TAAGACAGGCAGAGGGGAGAAGG + Intergenic
1040981043 8:53246412-53246434 CATGACAGGCAGGAGGATGAAGG + Intronic
1041154969 8:54976733-54976755 GAGGACAAGCAGAAGCAGGGAGG + Intergenic
1041866670 8:62582084-62582106 AAGGAAAGACAGAAGGAGGGAGG - Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043795609 8:84534706-84534728 GAGAACAGGGAGAAGAAGGAAGG + Intronic
1043916523 8:85929024-85929046 TGGGTCAGGCAGAAAGAGTAGGG - Intergenic
1044801948 8:95966151-95966173 TAAGAGAGGGAGAAGGAGGAAGG + Intergenic
1044845007 8:96371926-96371948 TAGGACTGGAAGAAAGAAGAGGG - Intergenic
1045733578 8:105268560-105268582 TAGGACAGGCAGGAGCAAGATGG - Intronic
1045824434 8:106380116-106380138 TAGGACTGGGAGAAGGGGAAGGG - Intronic
1047026192 8:120827047-120827069 TAGGAAAGGAAGAAAGAGGCAGG - Intergenic
1047039822 8:120980588-120980610 TAGGAAGGGCTGAAGGAGGCAGG - Intergenic
1047214297 8:122864203-122864225 AGGGACAGGCAGTGGGAGGAGGG + Intronic
1047599023 8:126408043-126408065 CAGGAGAGGCAGTAGGATGAGGG - Intergenic
1047702565 8:127464240-127464262 TAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1048165928 8:132061386-132061408 AGGGACAGAGAGAAGGAGGAAGG - Intronic
1049554467 8:143275171-143275193 TAGGGGATGCAGGAGGAGGAGGG - Intronic
1049558185 8:143294087-143294109 CAGGAGGGGCAGCAGGAGGAGGG - Intronic
1049916722 9:324710-324732 TGGGACAGTCAGAAGAAGGCTGG - Intronic
1052971906 9:34381642-34381664 TAGGAAGGGCTGAAGGTGGATGG + Intronic
1053096552 9:35333545-35333567 GATGAAAGGGAGAAGGAGGAAGG - Intronic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1053696841 9:40647385-40647407 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1053800345 9:41760068-41760090 GAGGCCAGGCAGAAGCAGCATGG + Intergenic
1054144853 9:61554767-61554789 GAGGCCAGGCAGAAGCAGCATGG - Intergenic
1054188772 9:61972220-61972242 GAGGCCAGGCAGAAGCAGCATGG + Intergenic
1054308092 9:63446618-63446640 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1054406825 9:64770609-64770631 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1054440450 9:65256075-65256097 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1054452956 9:65413101-65413123 TAGGACAGGGAGAAGCAGCCTGG - Intergenic
1054464545 9:65485724-65485746 GAGGCCAGGCAGAAGCAGCATGG - Intergenic
1054489957 9:65765849-65765871 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
1054649749 9:67616397-67616419 GAGGCCAGGCAGAAGCAGCATGG - Intergenic
1054725669 9:68647567-68647589 TAGGTCAGGCTGGAGGATGAGGG - Intergenic
1054762042 9:69012755-69012777 TAAAACAGGCAGAAGGGGGCTGG + Exonic
1054969579 9:71069561-71069583 TAGGACAGGTAGGAATAGGAGGG + Intronic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055107019 9:72523611-72523633 TTGAATAGGCTGAAGGAGGAGGG + Intronic
1055120936 9:72660014-72660036 AAGGACAGGCAGGAGGAATAAGG - Intronic
1055775988 9:79767632-79767654 TGGGAGAGGGAAAAGGAGGATGG - Intergenic
1057743612 9:97733972-97733994 TGGCAGAGGCAGAGGGAGGAGGG + Intergenic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1060163903 9:121392780-121392802 TATGACAGACAGAAGTATGATGG - Intergenic
1060187359 9:121571869-121571891 CAGGACAGTCAGAGGCAGGAAGG + Intronic
1060860810 9:126953413-126953435 TGAGAGAGGCAGAAGGAGGGTGG + Intronic
1060892167 9:127195815-127195837 TAGGAAAGAAGGAAGGAGGAAGG - Intronic
1061413024 9:130431238-130431260 CAGGACAGGGAGAAGGAGCAGGG + Intronic
1061594192 9:131618377-131618399 TAGGACAGGGGGTAGCAGGATGG - Intronic
1061656790 9:132098047-132098069 GAGGAAAGGGAGAAGGTGGATGG + Intergenic
1061930791 9:133832116-133832138 GAGGACAGGAAGAAGGTGCAGGG + Intronic
1061962760 9:133996761-133996783 TAGTACAGGCAGGAGTAGCAAGG + Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062097919 9:134712292-134712314 GGGGACAGGAAGAAGGGGGAAGG - Intronic
1062138313 9:134941535-134941557 TCAGACAAGCAGAATGAGGATGG + Intergenic
1062144046 9:134979062-134979084 GAGGAAAGAGAGAAGGAGGAAGG + Intergenic
1062473021 9:136714496-136714518 GAGGACAGCCAGGAGGAGGGAGG - Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1202779293 9_KI270717v1_random:21044-21066 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1203617107 Un_KI270749v1:75774-75796 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
1185926441 X:4152321-4152343 TTGGACACTCAGAAGGGGGAGGG - Intergenic
1186479020 X:9881716-9881738 TCGGGGAGGCAGAGGGAGGAAGG - Intronic
1186652933 X:11580405-11580427 TAGGACAGGAAGAAAGGGGAGGG - Intronic
1186675121 X:11808414-11808436 AAGGACAGTGAGAAGAAGGAAGG + Intergenic
1186898774 X:14031579-14031601 TGGGAAAGGCAGAAGGATGCAGG + Intergenic
1187182537 X:16956602-16956624 CAGGACAGACTGGAGGAGGAGGG - Intronic
1187380613 X:18798560-18798582 GTGGACAGGGAGCAGGAGGAAGG + Intronic
1188073765 X:25749781-25749803 TAGGAAAGGAAAGAGGAGGATGG - Intergenic
1188440352 X:30209934-30209956 TAGGACAGTCATCAGGAGGCTGG - Intergenic
1188986167 X:36770202-36770224 TAGGACCTGCAGAAGGTAGATGG - Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1190123401 X:47682646-47682668 AAGGAAAGAAAGAAGGAGGAAGG - Intergenic
1190593966 X:52034496-52034518 TAGGCCAGGCATTAGGAGTAAGG + Intergenic
1190734709 X:53248653-53248675 AAGGACAGCAAGAGGGAGGAAGG - Intronic
1191112152 X:56812370-56812392 TAGGGAGGGCAGAAAGAGGAGGG - Intergenic
1192050067 X:67716644-67716666 AATGCCAGGCAGAAAGAGGATGG + Intronic
1192207568 X:69106415-69106437 CAGAACAGGCACAAGGAGGGGGG - Intergenic
1192353167 X:70373323-70373345 AAGGAAAGGAAGAAGGAAGAAGG + Intronic
1193228498 X:79013712-79013734 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1194764104 X:97829300-97829322 GAGATCAGGGAGAAGGAGGAAGG - Intergenic
1195935996 X:110126241-110126263 TAGGGCTGACAGAAGGACGAGGG + Intronic
1196124222 X:112082347-112082369 AAGGAGAGGGAGAAGGAGGGAGG + Exonic
1197758150 X:130010526-130010548 TTGGACTGGCAGAAGTGGGAGGG - Intronic
1197841311 X:130750046-130750068 GCAGACAGGCAGAGGGAGGAAGG - Intronic
1199090354 X:143684365-143684387 TAGGAGAGGGAAAAGGAAGAAGG + Intergenic
1199783169 X:151081943-151081965 CAGGACACACAGAAGGAGAATGG + Intergenic
1200890817 Y:8322201-8322223 TAGGACAGGCACAAAGATGGTGG + Intergenic
1201194569 Y:11479325-11479347 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1202170264 Y:22036025-22036047 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202221101 Y:22550348-22550370 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic
1202322011 Y:23645314-23645336 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202548756 Y:26024742-26024764 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic