ID: 1058480694

View in Genome Browser
Species Human (GRCh38)
Location 9:105391444-105391466
Sequence TGAGTTGCAAATTAATTGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058480694 Original CRISPR TGAGTTGCAAATTAATTGCC AGG Exonic
905313843 1:37068597-37068619 TAAGTTGGAATTTAAATGCCTGG - Intergenic
907711699 1:56888999-56889021 TGGATTACTAATTAATTGCCTGG + Intronic
907714864 1:56917162-56917184 AGAGTTTCAAATTAAGTGCAAGG + Intronic
910146021 1:84080261-84080283 TGAGTTGCAAATTAATACTAAGG - Intronic
913456690 1:119039202-119039224 TGTGTTGAGAATTATTTGCCAGG - Intronic
915474638 1:156146513-156146535 GGAGTTTGAAATTAATTGCATGG + Intergenic
916369516 1:164074463-164074485 TGAGTTGCAAAATAAGTTCAGGG - Intergenic
917220459 1:172723096-172723118 TGAGGTGCAAATTATTAGCAGGG + Intergenic
918309910 1:183278529-183278551 TGAGTAGCAAGGTTATTGCCTGG - Intronic
918670842 1:187214257-187214279 TGATTTTCAAATGAATTACCTGG + Intergenic
919091099 1:192979712-192979734 TTGGTGGCAAATCAATTGCCGGG - Intergenic
919574349 1:199288517-199288539 CGAGTTGAAAACTAAATGCCTGG + Intergenic
920684283 1:208097198-208097220 TGACATGAAAATTAATTGCAAGG + Intronic
922788976 1:228299428-228299450 TGAGCTGCAGATTCATGGCCTGG + Exonic
923771783 1:236943768-236943790 TGAGTTGCATTTTATGTGCCAGG - Intergenic
1063531989 10:6842181-6842203 CTTGGTGCAAATTAATTGCCTGG + Intergenic
1064454110 10:15470738-15470760 GGAGGTGAAAATTAATTGACTGG + Intergenic
1064685580 10:17857831-17857853 TGAATTGAAAATTAAATCCCAGG - Intronic
1064802089 10:19088052-19088074 TGAGTGGCAAATTAATGGTTGGG + Exonic
1064826288 10:19406109-19406131 TGAGTTGCAAATTGTTTTCAGGG + Intronic
1066126118 10:32345007-32345029 AGAATTACAAATTAATTTCCAGG + Intronic
1066233768 10:33465451-33465473 TCTGCTGCAAATTAATTGCCTGG + Intergenic
1066490521 10:35889672-35889694 TAAGCCGCAAATTAATTGCAAGG - Intergenic
1067398929 10:45952930-45952952 AGAGTTGCAAATGCCTTGCCAGG - Intergenic
1067867249 10:49922143-49922165 AGAGTTGCAAATGCCTTGCCTGG - Intronic
1068400725 10:56524482-56524504 TATGTTGCAAATTAATTTACAGG - Intergenic
1068824921 10:61425711-61425733 AGAGCTGCAAATTAATGTCCTGG + Intronic
1069102335 10:64337619-64337641 TCAGTTGCAAATTAATTTTCTGG - Intergenic
1069946383 10:71988860-71988882 TGAGATGAAAATGATTTGCCAGG + Intronic
1071113069 10:82184951-82184973 TAAGCTGCTAATTAATTGACAGG + Intronic
1072576052 10:96701198-96701220 TGACTTGGAAATTTATGGCCTGG + Intronic
1072832253 10:98671151-98671173 AGATTTGCTAATGAATTGCCTGG + Intronic
1075266217 10:121001376-121001398 TGAGTTGCACTTTGATTGACAGG - Intergenic
1081429996 11:42966516-42966538 TGTGTTGCAAATTCTTTGCTGGG - Intergenic
1082199302 11:49344178-49344200 TAAGTTGCAACTTGATTTCCTGG + Intergenic
1085577397 11:77619173-77619195 GGAGTAGCAAATAAATTGTCAGG + Intronic
1086656516 11:89363944-89363966 TAAGTTGCAACTTGATTTCCTGG - Intronic
1088853921 11:113729201-113729223 TGAGTTTCAAATACACTGCCTGG + Intergenic
1090956665 11:131519159-131519181 TGAGTTTCAAATTGAGAGCCAGG + Intronic
1091349372 11:134880908-134880930 GGAGTTGCTAAATATTTGCCTGG + Intergenic
1095530878 12:43184782-43184804 TCAGTTTCTAATTAATTGCATGG + Intergenic
1095695692 12:45141970-45141992 TATGTTGAAATTTAATTGCCAGG + Intergenic
1096111388 12:49031282-49031304 TGAGTTGCACATTCTTTGCCCGG + Exonic
1097572555 12:61352949-61352971 AGGGTACCAAATTAATTGCCTGG - Intergenic
1097741457 12:63247624-63247646 TTTGTAGCAAATTACTTGCCTGG + Intergenic
1098221662 12:68276382-68276404 TGAGTTGGAGAATAATTGCGGGG + Intronic
1103045774 12:117733381-117733403 TGAGTGGGAAATGAATGGCCAGG - Intronic
1103921560 12:124402089-124402111 AGAGTTCCAAAGTCATTGCCTGG + Intronic
1105012117 12:132762496-132762518 TGACTTTCAAAATATTTGCCCGG - Intergenic
1106402714 13:29445170-29445192 TTATTTGTAAATCAATTGCCAGG - Intronic
1107212945 13:37879922-37879944 TGATTTGTAAATTTATTGACAGG - Intergenic
1108188337 13:47910768-47910790 TGAGTTGTAATTTGATTGCACGG - Intergenic
1109495937 13:63171913-63171935 AGAGTTTCAAATTGATTGGCTGG + Intergenic
1110554650 13:76844700-76844722 TTAGTTAAAAATTAATTTCCTGG - Intergenic
1111218278 13:85173066-85173088 TTATTTGCAAATTATTTTCCAGG - Intergenic
1112072208 13:95866251-95866273 TGAGTTTAAAAATAATTGCTGGG - Intronic
1112089136 13:96064136-96064158 TGAGTTGAAAATCAACTGGCAGG + Intergenic
1114559989 14:23582646-23582668 TGAGCTGCAAATTAAGTGTAGGG + Intergenic
1115829601 14:37321417-37321439 TGAGTTGGAATTTAATTCCCTGG + Intronic
1116044097 14:39721715-39721737 TGAGTTGCAGATCAAATGTCTGG - Intergenic
1121574508 14:94972657-94972679 TGAGTTGAACCTTAATTCCCTGG + Intergenic
1123401687 15:19993690-19993712 TGAGTGGCAAAATCCTTGCCTGG - Intergenic
1123511030 15:21000351-21000373 TGAGTGGCAAAATCCTTGCCTGG - Intergenic
1123676941 15:22719234-22719256 TTAGTTGAAAATTACTTGCATGG + Intergenic
1123858150 15:24435292-24435314 TAATTTGCAAATGTATTGCCTGG + Intergenic
1124329158 15:28793512-28793534 TTAGTTGGAAATTACTTGCATGG + Intergenic
1128940996 15:71787547-71787569 TGATGTGCATATGAATTGCCTGG + Intergenic
1131537033 15:93246027-93246049 TAGGTTGGAAATAAATTGCCTGG - Intergenic
1131706488 15:95001689-95001711 TGAGATGCAAATTCATTGCCTGG - Intergenic
1133891822 16:9886434-9886456 GGAGTTGCAAATCACTTGCATGG + Intronic
1134568185 16:15269046-15269068 TGGCTTGCAAATTTAATGCCTGG - Intergenic
1134568428 16:15271007-15271029 TGGCTTGCAAATTTAATGCCTGG - Intergenic
1134734001 16:16485353-16485375 TGGCTTGCAAATTTAATGCCTGG + Intergenic
1134734248 16:16487309-16487331 TGGCTTGCAAATTTAATGCCTGG + Intergenic
1134933253 16:18224970-18224992 TGGCTTGCAAATTTAATGCCTGG - Intergenic
1134933497 16:18226928-18226950 TGGCTTGCAAATTTAATGCCTGG - Intergenic
1135783198 16:25324447-25324469 TGAGTTGCTGAATAATAGCCTGG + Intergenic
1158333043 18:56384038-56384060 TAATTTGCAAATTAATTGTGAGG + Intergenic
1159649145 18:70956613-70956635 TGATTTGCAAATTAAAGGACAGG + Intergenic
1159700958 18:71625868-71625890 TGAATTGCAAATGAAATTCCAGG - Intergenic
1160750399 19:731359-731381 TGAGCTGGAAATCAAGTGCCTGG - Intronic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
925626163 2:5843723-5843745 TGAGTTTCAAAGTAAGTGCCTGG + Intergenic
925824668 2:7835897-7835919 TGAGAAACAAATTAATTCCCCGG - Intergenic
928289933 2:30028121-30028143 TGAGTTGCAAAATAAAATCCCGG - Intergenic
929286008 2:40135917-40135939 TGAGCTGCAAATTACATGTCTGG + Intronic
931223545 2:60309855-60309877 TGAGTTGGAAATAAAATCCCAGG + Intergenic
931855316 2:66296973-66296995 TGAGTTGAAAATAATTTTCCAGG + Intergenic
933294745 2:80476520-80476542 TTAGTTGTAAAACAATTGCCTGG - Intronic
933804225 2:85986678-85986700 TGAGTTGAAACCTATTTGCCAGG - Intergenic
935287242 2:101575925-101575947 TTAATTGCAAATTAATTGAATGG + Intergenic
937049867 2:118879613-118879635 AGAGTTGCCATTTATTTGCCTGG + Intergenic
938086741 2:128406881-128406903 TGATTTGCAAATTCCTTGACAGG - Intergenic
939103441 2:137922324-137922346 TGATTTGGAAATTATTTGTCTGG + Intergenic
940141239 2:150493338-150493360 TGATTTTCAAATTCAGTGCCAGG - Intronic
941224167 2:162824811-162824833 TGAGATGCAAACTGATGGCCAGG - Intronic
943027128 2:182643296-182643318 TGAGAGGTTAATTAATTGCCTGG + Intergenic
943055060 2:182966846-182966868 AGTGTTGGAAATTAAATGCCTGG - Intronic
943370212 2:187007177-187007199 TAAATTAAAAATTAATTGCCAGG + Intergenic
944106126 2:196081570-196081592 TTATTTTCAAAATAATTGCCTGG + Intergenic
946125938 2:217562724-217562746 TGACTTGCAAATTAACAGCCTGG - Intronic
947969869 2:234313909-234313931 TGATTTGCAAAAATATTGCCTGG + Intergenic
1168731617 20:87551-87573 AGTGTTGCAAATTAATGGTCTGG + Intronic
1170980836 20:21211334-21211356 GGACTTGGAAATTAAATGCCAGG - Intronic
1171155005 20:22864026-22864048 TGAGCTGCAAATGAATTTCGTGG + Intergenic
1173432198 20:42998378-42998400 TAATTTGCATATCAATTGCCAGG - Intronic
1177315278 21:19452459-19452481 TGAGTTGCAAACTAAAAGTCTGG - Intergenic
1177357090 21:20022287-20022309 TGAGTTACAATGTAACTGCCTGG - Intergenic
1178303759 21:31473484-31473506 TGAGTTGCATATTAGATCCCAGG + Intronic
1182503340 22:30764441-30764463 TGAGGTGGAAATAAATTCCCAGG + Intronic
1183519924 22:38291063-38291085 TGAGTTATAAATTACTTCCCTGG - Exonic
951913349 3:27774110-27774132 TGAGTCCCTAATTAACTGCCTGG - Intergenic
955464651 3:59224159-59224181 TGAGTTCTAATTTGATTGCCTGG + Intergenic
957761167 3:84558830-84558852 GGAGTTGTAAATTAATTTCCAGG + Intergenic
958815443 3:98909281-98909303 TGAGTTCCAATTTGATTGCATGG - Intergenic
959750770 3:109831888-109831910 TGGGATGCTAATTAATTACCTGG - Intergenic
961242264 3:125421567-125421589 AGAAATGCAAATTTATTGCCTGG + Intergenic
961860108 3:129909958-129909980 TGATATGCAAATGAATTGCCTGG - Intergenic
963317030 3:143770763-143770785 AGAGTTGCAAATATATTTCCTGG - Intronic
965608772 3:170523115-170523137 GGAGATGCATATTAATTGCCTGG - Intronic
967000276 3:185327517-185327539 TGATCTCCAAATTTATTGCCTGG + Intronic
968230048 3:197000187-197000209 TGATGTGCACATTAACTGCCTGG - Intronic
969288695 4:6224672-6224694 AGAGCTGCAAATTAATTGATTGG - Intergenic
979580414 4:122352298-122352320 TGAGTTACAAAGTACTTGCATGG - Intronic
983686604 4:170417299-170417321 TGAGTAACAAATTAATTTCTAGG - Intergenic
984093938 4:175410910-175410932 TGACTTGCAGATGAATTGCAAGG + Intergenic
985280551 4:188282505-188282527 TGGTTAGCAAATTAATTGACTGG + Intergenic
985810465 5:2079787-2079809 TGAGAAGTAAATTAATTGTCAGG + Intergenic
987015482 5:13814360-13814382 TGGGTTGTAGAGTAATTGCCAGG - Intronic
989403729 5:41037485-41037507 TTAGTTGCATAAGAATTGCCTGG - Intronic
990342294 5:54835348-54835370 TTATTTCCAAATTAAATGCCTGG - Intergenic
994111489 5:96009848-96009870 TTAGTTGAAAATTATTTGCCAGG + Intergenic
994137689 5:96306779-96306801 TGAGTTCCAATTTGATTGCCTGG + Intergenic
994218945 5:97172352-97172374 TGAGTAGCAAATTAACTGGAAGG - Intronic
994716339 5:103326290-103326312 TGAATTGCATTTGAATTGCCTGG - Intergenic
994996861 5:107075186-107075208 TGAGTAGCAATTTAATTCTCTGG - Intergenic
1005017595 6:21389066-21389088 TGATTTGAAAATTAATTGGCCGG + Intergenic
1006640727 6:35488334-35488356 TGTGGTCCAAATTAATAGCCTGG - Intronic
1008308641 6:49937199-49937221 TGAGTTGCAATTTCATGACCTGG - Intergenic
1015695443 6:135975269-135975291 TAAGTTGCAAAGTAGTGGCCTGG - Intronic
1016150416 6:140734855-140734877 GAACTTGCAAATTAAGTGCCTGG - Intergenic
1018186831 6:161272916-161272938 TGAGTAACAAATTAACTGCCGGG - Intronic
1021642936 7:22757800-22757822 TGAGTTGCTAATAACTTCCCTGG + Intergenic
1022644513 7:32217926-32217948 TAAAATGCACATTAATTGCCTGG + Intronic
1022871140 7:34481140-34481162 TTAGGTGCATACTAATTGCCAGG + Intergenic
1027733640 7:81906005-81906027 TGAGTTACAACTTACATGCCAGG - Intergenic
1028112420 7:86958006-86958028 TGTGATGCAAATTAATATCCTGG - Intronic
1028172226 7:87612100-87612122 TGAGTTGCAAAGTGAGTGGCAGG + Intronic
1028547457 7:92019505-92019527 TTATTTGCTAATTAAATGCCAGG + Intronic
1030788520 7:113693945-113693967 TAAGATGCATATTAATTACCTGG - Intergenic
1031757280 7:125660907-125660929 TCAGTTGCTAACAAATTGCCTGG - Intergenic
1032370353 7:131343820-131343842 TGAATTGCAAATTAATCTTCTGG + Intronic
1032381944 7:131493877-131493899 TGAATGCCAAATTAATTGGCAGG + Exonic
1034671318 7:152860791-152860813 TGATTGGCAAAATAATTGCATGG + Intergenic
1036029356 8:4949859-4949881 TTAGTTCAAAAGTAATTGCCTGG + Intronic
1039717949 8:40131615-40131637 TGAATTCTAAATTAATTTCCTGG + Intergenic
1040731536 8:50453686-50453708 TGTATTACCAATTAATTGCCAGG - Intronic
1041051665 8:53940583-53940605 GGAGTTGAAAATGAAATGCCCGG + Intronic
1042708403 8:71687377-71687399 TTAATTGCTGATTAATTGCCTGG + Intergenic
1047695668 8:127401269-127401291 AGAGTTGCACAGTTATTGCCTGG - Intergenic
1056161459 9:83899414-83899436 TGATTTATAAATTAATTTCCTGG + Intronic
1056358670 9:85829833-85829855 TGATTTATAAATTAATTTCCTGG - Intergenic
1057369735 9:94459647-94459669 GGAGTTGCACATTATTTGCAAGG - Exonic
1058480694 9:105391444-105391466 TGAGTTGCAAATTAATTGCCAGG + Exonic
1058875051 9:109236939-109236961 AGAGTTGTAAATCAATTCCCTGG - Intronic
1059244018 9:112834229-112834251 TAATTTGCACATTATTTGCCTGG + Intronic
1185805449 X:3053125-3053147 TGAGTTGCATATTAAATTCCAGG + Intronic
1198324041 X:135549665-135549687 TGAGCAGCAAATGAATTGCTTGG - Exonic
1199089345 X:143672781-143672803 TCAATTGCTAATTTATTGCCTGG + Intergenic
1201275412 Y:12292714-12292736 TGAGTTGCATATTAAATTCCAGG - Intergenic