ID: 1058498784

View in Genome Browser
Species Human (GRCh38)
Location 9:105589944-105589966
Sequence CTTACAAGACCCTAAGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058498784_1058498792 30 Left 1058498784 9:105589944-105589966 CCTGTTACTTAGGGTCTTGTAAG No data
Right 1058498792 9:105589997-105590019 AGTGAGACTGGGAAACAGGAAGG No data
1058498784_1058498789 19 Left 1058498784 9:105589944-105589966 CCTGTTACTTAGGGTCTTGTAAG No data
Right 1058498789 9:105589986-105590008 CTTTTATCCTGAGTGAGACTGGG No data
1058498784_1058498788 18 Left 1058498784 9:105589944-105589966 CCTGTTACTTAGGGTCTTGTAAG No data
Right 1058498788 9:105589985-105590007 CCTTTTATCCTGAGTGAGACTGG No data
1058498784_1058498791 26 Left 1058498784 9:105589944-105589966 CCTGTTACTTAGGGTCTTGTAAG No data
Right 1058498791 9:105589993-105590015 CCTGAGTGAGACTGGGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058498784 Original CRISPR CTTACAAGACCCTAAGTAAC AGG (reversed) Intronic