ID: 1058499450

View in Genome Browser
Species Human (GRCh38)
Location 9:105595825-105595847
Sequence ATCTATAAGCTATAGATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058499450_1058499453 -6 Left 1058499450 9:105595825-105595847 CCTCCCATCTATAGCTTATAGAT 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1058499453 9:105595842-105595864 ATAGATAACGTATGCACTCAAGG No data
1058499450_1058499454 12 Left 1058499450 9:105595825-105595847 CCTCCCATCTATAGCTTATAGAT 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1058499454 9:105595860-105595882 CAAGGCATAAGAAACTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058499450 Original CRISPR ATCTATAAGCTATAGATGGG AGG (reversed) Intronic
901110825 1:6793010-6793032 ATATATAAGATATATATGAGTGG - Intronic
901315029 1:8301260-8301282 ATCAATAACCTATAGCTGAGTGG + Intergenic
901315044 1:8301344-8301366 ATCAATAACCTATAGCTGGGTGG + Intergenic
901315063 1:8301456-8301478 ATCAATAACCTATAGCTGGCTGG + Intergenic
901811742 1:11771345-11771367 ATTTAAAAGCTATTGCTGGGGGG - Intronic
903277434 1:22231060-22231082 ATAGATAAACTATGGATGGGTGG - Intergenic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
910684062 1:89898235-89898257 ATCTAAAAGCAATTCATGGGAGG + Intronic
912149234 1:106836724-106836746 ATATATAACCTATATATGGTGGG + Intergenic
916158608 1:161885481-161885503 AGCTGTATGCTATTGATGGGAGG + Intronic
916374607 1:164138756-164138778 ATCAATTAGCTATATATGCGTGG - Intergenic
920824115 1:209409281-209409303 ATCTATAAGTTAAGGGTGGGTGG - Intergenic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
1068503320 10:57867683-57867705 ATCTACAAGCTTTAGATGTAAGG + Intergenic
1071039870 10:81294227-81294249 ATCAATAAGCTGTAAATGAGTGG + Intergenic
1076227421 10:128791230-128791252 ATCCATGAGCAATAGATAGGTGG + Intergenic
1082630989 11:55541777-55541799 ATCTATAAGACCTTGATGGGTGG - Intergenic
1092742355 12:11642013-11642035 ATCAATAGGATATAGATGGATGG - Intergenic
1092930516 12:13311265-13311287 ATTTATAAGCAATAGAGGGCAGG - Intergenic
1093529624 12:20145667-20145689 ATCTAAAAGCCATGGATAGGGGG - Intergenic
1100055028 12:90498570-90498592 ATCTATAAATTAGAGATGGAAGG - Intergenic
1102090360 12:110182246-110182268 CTATAGAAGCTATAGCTGGGTGG - Intronic
1102548391 12:113673267-113673289 ATATGTTAGCTATAGAAGGGAGG - Intergenic
1106634509 13:31512961-31512983 AGATATTAGCTATAGATAGGTGG + Intergenic
1114438054 14:22724536-22724558 AACTATAAGCTATTTATAGGAGG + Intergenic
1118525851 14:66641620-66641642 TTCTATCAGCTATTGATGGTTGG - Intronic
1118692448 14:68352953-68352975 CTCTATAGGCTAAACATGGGAGG - Intronic
1121637689 14:95464921-95464943 AAATATAAGCTATATCTGGGAGG + Intronic
1132351690 15:101143265-101143287 AGCTATAAACTAGAGATGTGAGG + Intergenic
1136117813 16:28106349-28106371 ATCTGAAAACTATAGATGGTGGG + Intronic
1139315930 16:66068746-66068768 ATCTAAAAGCTATACATCTGGGG - Intergenic
1141257941 16:82420762-82420784 ATCTGCATGCTATAGATGAGAGG - Intergenic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1145404804 17:22578862-22578884 TTCAATAAGGTATATATGGGAGG + Intergenic
1146121909 17:30203201-30203223 ACCGATAAGCTATATATGTGGGG + Exonic
1146799178 17:35805085-35805107 GACTATAAGCTGTAGGTGGGGGG + Intronic
1147391839 17:40114084-40114106 TTCTATAAGCCTTAGAGGGGTGG + Intergenic
1153240508 18:3027326-3027348 TTTTAGAAGCTATAGAGGGGAGG + Intergenic
1153967436 18:10194750-10194772 ATCTGAAAGCTTTAGAGGGGAGG - Intergenic
1154510764 18:15099233-15099255 ATCTATAGGCTATAGATATGTGG + Intergenic
1155999450 18:32368572-32368594 ATTTATAACCTCTAGATGGCAGG + Intronic
1160727994 19:626448-626470 ATATTTAAGCTATACATGGCTGG - Intronic
1163747846 19:19058622-19058644 ATCTATAAGATAGACATCGGCGG + Intronic
1167753915 19:51398873-51398895 ATATAAAAGGTATAGAGGGGAGG - Intergenic
926377472 2:12248077-12248099 ATCTGTAAGTTAAAGATGGTTGG - Intergenic
929264022 2:39898650-39898672 ATCAACCAGCTATAAATGGGAGG + Intergenic
929674566 2:43912989-43913011 ATCTTTAATCTATAAGTGGGTGG + Intronic
932465326 2:71919150-71919172 ATCAATAAGCCATATATGTGAGG - Intergenic
932744967 2:74326356-74326378 ATCTATGATCTAAAGATGGATGG - Intronic
936739924 2:115492527-115492549 ATTTATGAGCCTTAGATGGGCGG + Intronic
938505985 2:131883692-131883714 ATCTATAGGCTATAGATATGTGG + Intergenic
942267591 2:174243928-174243950 ATCTACAAGATATAGATTGTGGG - Intronic
943236404 2:185326186-185326208 ATCTGTAAGGAATAGATGTGAGG + Intergenic
945418245 2:209601563-209601585 ATCAATAGGCTATAAAGGGGTGG + Intronic
946848846 2:223885551-223885573 ATTTGTAATCTATAGATAGGAGG + Intronic
1169957950 20:11126795-11126817 AGCTTTAAGATATAAATGGGGGG - Intergenic
1170039174 20:12022340-12022362 ATCTAACACCTACAGATGGGAGG - Intergenic
1173429668 20:42975707-42975729 TTCTGGAGGCTATAGATGGGTGG + Intronic
1176787089 21:13270046-13270068 ATCTATAGGCTATAGATATGTGG - Intergenic
1177742626 21:25172015-25172037 ATTTATAACCTATAGATAGCTGG - Intergenic
1177986256 21:27978685-27978707 ATCTATAGGCTATAGATATGTGG - Intergenic
1178181032 21:30161808-30161830 ATCTTTAACATATAAATGGGGGG + Intergenic
1184056556 22:42054903-42054925 ATCAATTAGCTATAGATGTATGG + Intronic
952971534 3:38653848-38653870 ATCTGTGAGCTCTAGATGGAGGG + Intergenic
954167716 3:48773721-48773743 ATGTTTAAGTTAAAGATGGGGGG - Intronic
954434656 3:50489710-50489732 ATGGATAAGCCATTGATGGGGGG - Intronic
955360134 3:58267134-58267156 ATCAGTAAGCTCTAGATGAGTGG - Intronic
964848785 3:161071595-161071617 ATCTACAAGCCATAGTAGGGGGG - Exonic
967902273 3:194466856-194466878 GTCTAAAAGCTTCAGATGGGTGG - Intronic
975397170 4:73889905-73889927 ATATATAATCTATATATGAGTGG + Intergenic
975874722 4:78822877-78822899 TTTGATAAGCTATAGATTGGTGG + Intronic
980029940 4:127815730-127815752 GACTGTAAGTTATAGATGGGTGG - Intronic
986363563 5:7006276-7006298 ATTTATAAGGTAAAGATGGAGGG + Intergenic
987138292 5:14920057-14920079 TTCTATAAGATAGAGATGAGCGG + Intergenic
989297899 5:39851132-39851154 CTTTATATGCTATAGACGGGGGG - Intergenic
989987017 5:50713136-50713158 ATCTATATGTTATAGATCTGTGG + Intronic
992484820 5:77184405-77184427 GTCTATAAACTATGGATGGTAGG + Intergenic
994115808 5:96060362-96060384 ATCCACATGCTATAGATGGTGGG + Intergenic
995887358 5:116910958-116910980 ATGTATAAGCAATACATGGAAGG + Intergenic
1004408451 6:15357701-15357723 ATCTTTAAACTGTAGATGGTGGG + Intronic
1023662942 7:42489284-42489306 ATATATATGCTATATATGTGAGG + Intergenic
1026237677 7:68542367-68542389 ATCTAAAAGGAATAGATGGTGGG + Intergenic
1027692818 7:81369570-81369592 ATATGTTAGCTATAGATGTGAGG - Intergenic
1034294229 7:149957680-149957702 ATCTGCAAGCTATAGAATGGGGG - Intergenic
1034811840 7:154139192-154139214 ATCTGCAAGCTATAGAATGGGGG + Intronic
1037974990 8:23202651-23202673 ATTTACAAGCTGTACATGGGAGG + Exonic
1048751213 8:137678560-137678582 AGCTATAGGCTTTAGATTGGGGG - Intergenic
1050601593 9:7258332-7258354 TTCTTAAAGCTACAGATGGGAGG + Intergenic
1050910169 9:11057693-11057715 ATCTGTAAGGTATAGAATGGGGG - Intergenic
1052549717 9:29932288-29932310 AGCTAGAAGCTATAGACTGGAGG - Intergenic
1058499450 9:105595825-105595847 ATCTATAAGCTATAGATGGGAGG - Intronic
1062140350 9:134953791-134953813 ATCAATAGGCCATAGATGTGAGG + Intergenic
1185926987 X:4158142-4158164 AACTATATGATATAGATGTGTGG + Intergenic
1189014490 X:37082415-37082437 TTCTATAAACTATAGATTGGAGG + Intergenic
1193701141 X:84762416-84762438 ATATATAAGCTATGGAAGAGAGG + Intergenic
1196799466 X:119529736-119529758 ATCTGTTGGCTATAGATGCGTGG + Intergenic
1198685065 X:139220087-139220109 ATCTCTTTGCTGTAGATGGGAGG - Intronic
1199003388 X:142667658-142667680 ATCTATAACCTAAAAATGTGAGG - Intergenic