ID: 1058499451

View in Genome Browser
Species Human (GRCh38)
Location 9:105595828-105595850
Sequence GTTATCTATAAGCTATAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058499451_1058499454 9 Left 1058499451 9:105595828-105595850 CCCATCTATAGCTTATAGATAAC 0: 1
1: 0
2: 0
3: 13
4: 129
Right 1058499454 9:105595860-105595882 CAAGGCATAAGAAACTTATTTGG No data
1058499451_1058499453 -9 Left 1058499451 9:105595828-105595850 CCCATCTATAGCTTATAGATAAC 0: 1
1: 0
2: 0
3: 13
4: 129
Right 1058499453 9:105595842-105595864 ATAGATAACGTATGCACTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058499451 Original CRISPR GTTATCTATAAGCTATAGAT GGG (reversed) Intronic
903838828 1:26223947-26223969 GCTATATATATGCTATATATTGG + Intergenic
905161586 1:36040185-36040207 GGAATCTATTAGCTATAGAGTGG + Intronic
907945070 1:59128472-59128494 GTTATCTACATTCTACAGATAGG + Intergenic
908881731 1:68740360-68740382 GATTTCTATATGCCATAGATTGG - Intergenic
908980404 1:69949623-69949645 TTAATCTATAACCTATTGATGGG + Intronic
916555730 1:165892789-165892811 GTGATATTTAAGCTTTAGATAGG + Intronic
916760070 1:167807642-167807664 CTTATATATGAGCTATAGATTGG - Intergenic
921282403 1:213579984-213580006 TTGATCCATAAGCTATAGAATGG - Intergenic
921548592 1:216504735-216504757 TTTATTTCTAAGCTATACATTGG + Exonic
924402109 1:243694800-243694822 GTTATCTATTAGCCATATTTGGG - Intronic
1062777336 10:163564-163586 TTTATCTATAAACCATAAATAGG - Intronic
1063281043 10:4629480-4629502 GTTATCTATAAAATATAATTTGG + Intergenic
1064740295 10:18426498-18426520 GTTTTCTATCAGACATAGATAGG + Intronic
1064920793 10:20515637-20515659 GTTATCTATCTGATATAGTTTGG - Intergenic
1065565788 10:27007830-27007852 GTTATTTATAATATATAGATAGG - Intronic
1066205338 10:33183448-33183470 GTTATCTACAAACTATAGGATGG - Intronic
1066511313 10:36099875-36099897 GTTATCTATTAGATTAAGATTGG - Intergenic
1068133921 10:52931730-52931752 TTTATCTAAAAGCTTCAGATAGG + Intergenic
1068274710 10:54778965-54778987 GTTATTTAAAAGCAATAGATAGG - Intronic
1071700372 10:87926275-87926297 GATATCTATAAATTATAGATAGG + Intronic
1071746213 10:88422379-88422401 ATTTGCTATAAGGTATAGATTGG - Intronic
1072051803 10:91712212-91712234 GTTTTCTATAAGGTATGGTTTGG - Intergenic
1078291990 11:10020966-10020988 GTTTTTTATTAGCTATTGATGGG - Intronic
1080114679 11:28608508-28608530 CATATCTATAAGGAATAGATAGG + Intergenic
1082044820 11:47716279-47716301 ATTATCTATAATATCTAGATTGG - Intergenic
1087848460 11:103000344-103000366 TTTATCTTTAAGCTGTAGAAAGG + Intergenic
1099203969 12:79707267-79707289 TTTATGTATAATCTAAAGATGGG - Intergenic
1100023758 12:90102489-90102511 GTTATGTTTAAGCATTAGATTGG - Intergenic
1107269444 13:38597602-38597624 GTTAACTATAGGATGTAGATAGG + Intergenic
1107799665 13:44093487-44093509 GTGATCTATAAATTATAGTTTGG - Intergenic
1111310190 13:86474198-86474220 ATGCTCTGTAAGCTATAGATAGG + Intergenic
1116251522 14:42489610-42489632 GTTATCTAAAAGCAGTAGAATGG + Intergenic
1127340584 15:58039334-58039356 GTTATATATAATCCATAGATAGG - Intronic
1133667405 16:7982517-7982539 TTTTTCTATAAGCTAGAGTTTGG + Intergenic
1135410274 16:22228902-22228924 GTTATTTAGAAGTTATACATAGG - Intronic
1143938870 17:10516973-10516995 GTTCTCTATAAGCCAATGATAGG - Intronic
1144117517 17:12112971-12112993 TTAATCTGTAAGATATAGATGGG - Intronic
1147775023 17:42894764-42894786 GTTTTCTACATACTATAGATGGG - Intergenic
1148418002 17:47522791-47522813 ATAATATATGAGCTATAGATTGG - Intergenic
1149082430 17:52675142-52675164 GTTATTTATAAGCCATTAATTGG + Intergenic
1149416384 17:56464237-56464259 GTTCACTATCAGCTGTAGATAGG - Intronic
1156686365 18:39651931-39651953 GTTCTCTATAAGATCTATATGGG - Intergenic
1158872604 18:61702928-61702950 GTTATCTATAAGCAATTAAGGGG - Intergenic
1159142260 18:64411724-64411746 CTTATCTATAAAATAAAGATGGG - Intergenic
1161841760 19:6685942-6685964 GTATTCTAGAACCTATAGATGGG + Intronic
1167062540 19:47158750-47158772 CTTCTTTATCAGCTATAGATGGG - Intronic
1168469052 19:56626164-56626186 GATATGTATAAGATATATATAGG + Exonic
926261437 2:11267293-11267315 ATTATCTCTATGCTATAGGTGGG + Intronic
926510153 2:13766311-13766333 ATTATCTATAAGATATAAATTGG + Intergenic
926822230 2:16864940-16864962 ATTATCCATAAGCTATATAGAGG - Intergenic
926994794 2:18722760-18722782 GCTATGTATAAGGTATAAATAGG + Intergenic
929624681 2:43394616-43394638 GGAATCTATAAGCTGTAGAAAGG + Intronic
929773312 2:44911359-44911381 CTTATCTATATGATACAGATAGG - Intergenic
930660933 2:54052463-54052485 ATTATATATAAGTTATATATGGG + Intronic
931120944 2:59219071-59219093 CTTATCTAGAAACTAGAGATAGG - Intergenic
932913917 2:75834486-75834508 GTTATCTATAAGCCCCTGATTGG - Intergenic
936456385 2:112677765-112677787 GTTATATATAAAATATATATTGG + Intergenic
936580721 2:113698203-113698225 CTTGTTTATAAGCTATTGATTGG + Intergenic
936800807 2:116262646-116262668 GTTATGTATATGCTCTTGATAGG - Intergenic
939488954 2:142853769-142853791 GATTTATATAAGCTATAGCTGGG + Intergenic
939906995 2:147929052-147929074 GTTATTTATAAACAATACATAGG + Exonic
941108332 2:161388776-161388798 ATTATATATAAGCTATTCATGGG - Intronic
943257077 2:185608688-185608710 GTTATCTATAAACTAATGATTGG + Intergenic
945160294 2:206883589-206883611 GTTAGCTACATGCTATAGAGGGG + Intergenic
1169277926 20:4246021-4246043 TTTATCTATAAAATAGAGATGGG - Intronic
1176293367 21:5058074-5058096 GTTATCTGTAATGTACAGATTGG + Intergenic
1177781896 21:25630792-25630814 GATATCCATCAGTTATAGATAGG + Intergenic
1179863893 21:44205574-44205596 GTTATCTGTAATGTACAGATTGG - Intergenic
949295852 3:2521439-2521461 CTTATCTAGAAGTTATAAATAGG - Intronic
949679471 3:6496073-6496095 GTTATCTCTAAGCTGCACATTGG - Intergenic
951002285 3:17576631-17576653 ATTATCTATAAGGTATACAAGGG + Intronic
952284567 3:31955995-31956017 GTTATATCCATGCTATAGATGGG + Intronic
952633916 3:35504620-35504642 GTTACCTATGAGTTATTGATTGG - Intergenic
955579302 3:60401646-60401668 ATTACTTATAAGGTATAGATAGG - Intronic
956903266 3:73739189-73739211 AGTATCTATATGCTATAGATAGG + Intergenic
957666810 3:83242937-83242959 ATTATCTATCATCTATATATTGG - Intergenic
959025165 3:101232649-101232671 GTTATATCTAGGCAATAGATGGG - Intronic
970991065 4:22213907-22213929 GTTTGCTATAATCTATAGAATGG + Intergenic
971004527 4:22358043-22358065 TTTATCTATAAGCTCTTGACTGG - Intronic
972185024 4:36518365-36518387 GGTATCTGTAAGCAGTAGATAGG - Intergenic
975375148 4:73634587-73634609 GTTATTTAAAAGATACAGATTGG + Intergenic
977069064 4:92360149-92360171 GTTATTTATAAGCAATACATTGG + Intronic
979698258 4:123638899-123638921 TTTATCTATAAGCTGCTGATTGG + Intergenic
981269887 4:142833228-142833250 GTCATCTAGAAGCTCTAGGTGGG + Intronic
983323177 4:166220962-166220984 GCAATTTATCAGCTATAGATGGG - Intergenic
984242917 4:177239331-177239353 GTAATCTAAAAGCTATAAAATGG + Intergenic
986057376 5:4152084-4152106 GTTATGTAAATGCTATACATAGG + Intergenic
987188569 5:15450409-15450431 ATTAGATATAAGCTAAAGATAGG - Intergenic
988231943 5:28490771-28490793 GTTATCTATAAGCCAGAAAGAGG + Intergenic
989297902 5:39851135-39851157 GTTCTTTATATGCTATAGACGGG - Intergenic
989488511 5:42021621-42021643 GATATGTTTAACCTATAGATTGG - Intergenic
989716561 5:44470143-44470165 GTTCTCTCTAGTCTATAGATTGG + Intergenic
992708415 5:79422509-79422531 TTTTTCTAAAATCTATAGATAGG - Intronic
993143507 5:84064909-84064931 ATTTTCGATAAGGTATAGATAGG - Intronic
996336033 5:122385100-122385122 GTTATCTCCAAGGTCTAGATTGG + Intronic
996928342 5:128855839-128855861 GTTATCTATGGTCTAGAGATGGG - Intronic
1000406517 5:160893543-160893565 TTTATCTATAAGCTCTTGATTGG - Intergenic
1000657286 5:163895265-163895287 GTTATCTATTACCCATAAATAGG - Intergenic
1004758175 6:18636367-18636389 GTTATCTAAAGGCTGCAGATTGG - Intergenic
1009718581 6:67432593-67432615 GTTATATATAATCTATATATAGG - Intergenic
1009718582 6:67432615-67432637 GTTATATATAATCTATATATAGG - Intergenic
1009827987 6:68892185-68892207 GTCATCTCTAAACTATAGTTTGG + Intronic
1010590192 6:77703230-77703252 GATATCTAGAAACTACAGATTGG - Intronic
1011848568 6:91597738-91597760 GTTATCTATAAGGCATTGTTAGG + Intergenic
1011940662 6:92838310-92838332 GTTATTGAGAAGCTATAAATGGG - Intergenic
1015038731 6:128690246-128690268 CTTCTCTGTAAGCTATAAATAGG + Intergenic
1016725026 6:147354101-147354123 GTTATCTCTAAGATAGAGGTGGG - Intronic
1018567582 6:165171403-165171425 GTTCTCTATATGCTATATTTTGG - Intergenic
1020824950 7:13015934-13015956 GTCATCTATAATCTAAAGAATGG - Intergenic
1021237933 7:18166007-18166029 GTTTTCTATAATCTTGAGATCGG - Intronic
1021680109 7:23121624-23121646 GTTATTAATAAGCTAAAGAAAGG - Intronic
1022715377 7:32892972-32892994 GTCATCTATATTCTCTAGATTGG - Intronic
1031628522 7:124018638-124018660 TTTTTCTATATGCTATAAATGGG - Intergenic
1033466582 7:141596281-141596303 TTTCTCTATAAGATATAGCTAGG - Intronic
1041763846 8:61395980-61396002 GTTATTTCTAAGGTATTGATAGG + Intronic
1043275471 8:78386717-78386739 TTTGTTTATAAGCAATAGATTGG - Intergenic
1045674860 8:104596019-104596041 CCAATCAATAAGCTATAGATGGG - Intronic
1046523451 8:115355104-115355126 TTTATCTATAAGCTATTACTGGG - Intergenic
1046578383 8:116060818-116060840 GTTTTCTTTAAGCTCAAGATAGG + Intergenic
1050102638 9:2134938-2134960 GTTATTTATAAGCTATATTAGGG + Intronic
1050227148 9:3472363-3472385 GTTATCTAGATTTTATAGATGGG - Intronic
1050227533 9:3476950-3476972 GTTATCTAGATTTTATAGATGGG - Intronic
1050507996 9:6367233-6367255 TTTATCTAGAAACAATAGATTGG + Intergenic
1052380651 9:27767373-27767395 GTTATCCCTAAACTATGGATGGG - Intergenic
1052549718 9:29932291-29932313 GATAGCTAGAAGCTATAGACTGG - Intergenic
1058254652 9:102745734-102745756 GGTCTCTATAAGATATGGATGGG + Intergenic
1058499451 9:105595828-105595850 GTTATCTATAAGCTATAGATGGG - Intronic
1058926945 9:109675413-109675435 ATTATTGATAAGCTATATATTGG + Intronic
1060425683 9:123503479-123503501 GTTATCTATGAGCTCTTGAAAGG + Intronic
1186539322 X:10383920-10383942 GTTAAGTATATGCTATAGTTTGG - Intergenic
1187032598 X:15503316-15503338 GTTACCTATAATCTTTCGATAGG - Intronic
1188591373 X:31840295-31840317 TATATTTATAAGCTAGAGATTGG + Intronic
1189014489 X:37082412-37082434 GCTTTCTATAAACTATAGATTGG + Intergenic
1192988277 X:76424028-76424050 ATCATCTGTTAGCTATAGATAGG + Intergenic
1193212545 X:78824380-78824402 GTTATATATAAGATATTGTTAGG - Intergenic
1194680338 X:96844354-96844376 GTTATGCATAAGCTTTACATAGG + Intronic
1196042819 X:111224177-111224199 ATTATCTATAAGTTAAAGCTAGG + Intronic
1196514025 X:116548336-116548358 GTTATTTATAAGCTATTATTAGG + Intergenic
1198043669 X:132878632-132878654 GTTATTTAGAAGCTATTCATTGG - Intronic
1201385375 Y:13435249-13435271 GTTATTTAGAAGTTATACATAGG + Intronic
1202262290 Y:22982471-22982493 GTTATCTCTGGGCTATAAATAGG - Intronic
1202415280 Y:24616212-24616234 GTTATCTCTGGGCTATAAATAGG - Intronic
1202455507 Y:25053874-25053896 GTTATCTCTGGGCTATAAATAGG + Intronic