ID: 1058499452

View in Genome Browser
Species Human (GRCh38)
Location 9:105595829-105595851
Sequence CGTTATCTATAAGCTATAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 62}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058499452_1058499454 8 Left 1058499452 9:105595829-105595851 CCATCTATAGCTTATAGATAACG 0: 1
1: 0
2: 0
3: 0
4: 62
Right 1058499454 9:105595860-105595882 CAAGGCATAAGAAACTTATTTGG No data
1058499452_1058499453 -10 Left 1058499452 9:105595829-105595851 CCATCTATAGCTTATAGATAACG 0: 1
1: 0
2: 0
3: 0
4: 62
Right 1058499453 9:105595842-105595864 ATAGATAACGTATGCACTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058499452 Original CRISPR CGTTATCTATAAGCTATAGA TGG (reversed) Intronic
906893671 1:49746704-49746726 TTTTATCTATAAGATATATAAGG - Intronic
911444246 1:97970933-97970955 CGTAATCTTTTAGCCATAGAAGG + Intergenic
923156553 1:231284486-231284508 CCTTATTTATAAGCTAAATAAGG + Intergenic
1068616902 10:59128824-59128846 CTTTATCTTAAAGCTATTGAAGG + Intergenic
1070872345 10:79767432-79767454 CTTTACCCATAAGATATAGATGG - Intergenic
1071082998 10:81835155-81835177 CGTTATTTTTAAACTATTGATGG + Intergenic
1071639266 10:87289603-87289625 CTTTACCCATAAGATATAGATGG - Intergenic
1071655971 10:87448346-87448368 CTTTACCCATAAGATATAGATGG + Intergenic
1072481447 10:95813261-95813283 CATATTCAATAAGCTATAGAAGG + Intronic
1073876687 10:107931618-107931640 TTTTATATAGAAGCTATAGAGGG - Intergenic
1085803712 11:79615084-79615106 CTTTCTCTATGAGGTATAGAGGG + Intergenic
1089501312 11:118933084-118933106 CGCTATCTATAGGATAAAGAAGG - Intronic
1097753832 12:63387256-63387278 CATACTCAATAAGCTATAGAAGG + Intergenic
1105079476 13:16090649-16090671 CGTTTTGTATAAGCTGCAGAAGG + Intergenic
1105743586 13:23355003-23355025 TGTTATCTATAAGCTTTGGCCGG - Exonic
1106807723 13:33328156-33328178 CTTAATCTAGAAGCCATAGATGG - Intronic
1107252415 13:38380021-38380043 CTTTATCTATAAGCAATTTATGG + Intergenic
1107721100 13:43248802-43248824 GGTTATATATAAACTATAAAAGG - Intronic
1110744690 13:79038805-79038827 TGTTATTTATAAGCTATATCTGG - Intergenic
1115263372 14:31475644-31475666 AGTATTCAATAAGCTATAGAAGG - Intergenic
1126022846 15:44419251-44419273 CGCTATCTGTAAGCATTAGATGG - Intergenic
1128394259 15:67207957-67207979 CTTTATCTTTATGCTACAGACGG - Intronic
1128654568 15:69451125-69451147 TATTATCTATAATATATAGATGG + Intergenic
1134834469 16:17349364-17349386 AGATATCAATAAGATATAGAAGG - Intronic
1139043974 16:63033801-63033823 CATATTCAATAAGCTATAGAAGG - Intergenic
1155999449 18:32368568-32368590 CCTTATTTATAACCTCTAGATGG + Intronic
1158872605 18:61702929-61702951 TGTTATCTATAAGCAATTAAGGG - Intergenic
1159142261 18:64411725-64411747 CCTTATCTATAAAATAAAGATGG - Intergenic
1164351079 19:27342877-27342899 CGTTTTTTATAATCTACAGAAGG - Intergenic
925550820 2:5072557-5072579 TCTTCTCTATATGCTATAGAAGG + Intergenic
927429088 2:23011752-23011774 CGTGAGCTATAAGCTGTATATGG - Intergenic
941469926 2:165871924-165871946 CATTATCTCTTAGTTATAGAAGG + Intronic
942338364 2:174915923-174915945 CATTATCTTTGAGTTATAGAAGG - Intronic
945160293 2:206883588-206883610 AGTTAGCTACATGCTATAGAGGG + Intergenic
947387408 2:229605333-229605355 CACTATATATAAGCTATACAGGG + Intronic
1183003777 22:34883264-34883286 CCTTATCTGTAAGATGTAGAAGG + Intergenic
1183651832 22:39160103-39160125 CTTCACCTATAAGCTATTGAAGG - Intergenic
951002284 3:17576630-17576652 AATTATCTATAAGGTATACAAGG + Intronic
951440378 3:22715805-22715827 ATATATCTATAAGCTGTAGAAGG - Intergenic
955821289 3:62898747-62898769 CATATTCAATAAGCTATAGAAGG + Intergenic
962071981 3:132043263-132043285 CCTTATCTCTAGCCTATAGATGG - Intronic
971240301 4:24882369-24882391 AGTTTTCTGTAAGCTATAGTTGG + Intronic
976917427 4:90394261-90394283 AGTTATCTATAAGATATATGAGG + Intronic
979397692 4:120208076-120208098 TTTTATCAATAAGCAATAGAGGG - Intergenic
981541448 4:145850601-145850623 CATTAACTCTAAGCAATAGATGG - Intronic
989297903 5:39851136-39851158 AGTTCTTTATATGCTATAGACGG - Intergenic
992410913 5:76504485-76504507 CCTTCTCTATATGGTATAGATGG + Intronic
993711980 5:91234380-91234402 AGTTATCTAAAAGGTAGAGAAGG - Intergenic
993822912 5:92642848-92642870 CGCTATCTGTAAGCTATGCATGG + Intergenic
995033066 5:107501127-107501149 CTTGATCTATATGCTGTAGAAGG - Intronic
997895846 5:137716551-137716573 CATATTCAATAAGCTATAGAAGG + Intronic
999103133 5:149044026-149044048 CGTTTTCTAGAAGGTAAAGAAGG - Intronic
1000933857 5:167284388-167284410 CATTCTCTCTATGCTATAGAAGG - Intergenic
1015982056 6:138849337-138849359 CTTTTTCTATAAGATACAGAAGG - Exonic
1020940961 7:14536644-14536666 AGTTATATATTAGATATAGAAGG + Intronic
1023340461 7:39213974-39213996 CAGCATCTATAAGCTATACAGGG - Intronic
1023802895 7:43850294-43850316 CATATTCAATAAGCTATAGAAGG + Intergenic
1031685434 7:124728041-124728063 AGTTATTTATAAGCTTCAGAAGG + Intergenic
1032134385 7:129262298-129262320 CATTTTCAATAAGCTATAGGAGG + Intronic
1038223365 8:25631819-25631841 CATTATCTAGAAGCAATACATGG + Intergenic
1050102637 9:2134937-2134959 TGTTATTTATAAGCTATATTAGG + Intronic
1058499452 9:105595829-105595851 CGTTATCTATAAGCTATAGATGG - Intronic
1189717027 X:43877513-43877535 CGTTATCTACATGCTGTACAAGG - Intronic