ID: 1058499453

View in Genome Browser
Species Human (GRCh38)
Location 9:105595842-105595864
Sequence ATAGATAACGTATGCACTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058499450_1058499453 -6 Left 1058499450 9:105595825-105595847 CCTCCCATCTATAGCTTATAGAT 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1058499453 9:105595842-105595864 ATAGATAACGTATGCACTCAAGG No data
1058499452_1058499453 -10 Left 1058499452 9:105595829-105595851 CCATCTATAGCTTATAGATAACG 0: 1
1: 0
2: 0
3: 0
4: 62
Right 1058499453 9:105595842-105595864 ATAGATAACGTATGCACTCAAGG No data
1058499451_1058499453 -9 Left 1058499451 9:105595828-105595850 CCCATCTATAGCTTATAGATAAC 0: 1
1: 0
2: 0
3: 13
4: 129
Right 1058499453 9:105595842-105595864 ATAGATAACGTATGCACTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058499453 Original CRISPR ATAGATAACGTATGCACTCA AGG Intronic
No off target data available for this crispr