ID: 1058502380

View in Genome Browser
Species Human (GRCh38)
Location 9:105634074-105634096
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058502379_1058502380 12 Left 1058502379 9:105634039-105634061 CCTGCTAGTTTTAGCTTTCTTTT 0: 1
1: 0
2: 9
3: 199
4: 2372
Right 1058502380 9:105634074-105634096 ATTTAGTTTACTTGATCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr