ID: 1058504593

View in Genome Browser
Species Human (GRCh38)
Location 9:105655350-105655372
Sequence CAGTGAAAAGGCTCTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058504589_1058504593 -10 Left 1058504589 9:105655337-105655359 CCCAGGAAACAGTCAGTGAAAAG No data
Right 1058504593 9:105655350-105655372 CAGTGAAAAGGCTCTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058504593 Original CRISPR CAGTGAAAAGGCTCTGAGGA AGG Intergenic
No off target data available for this crispr