ID: 1058519088

View in Genome Browser
Species Human (GRCh38)
Location 9:105801709-105801731
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058519088_1058519091 8 Left 1058519088 9:105801709-105801731 CCTTCTGGATATTAGGACCAGTA No data
Right 1058519091 9:105801740-105801762 TGTACACACACTGCGATATTGGG No data
1058519088_1058519090 7 Left 1058519088 9:105801709-105801731 CCTTCTGGATATTAGGACCAGTA No data
Right 1058519090 9:105801739-105801761 GTGTACACACACTGCGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058519088 Original CRISPR TACTGGTCCTAATATCCAGA AGG (reversed) Intergenic
No off target data available for this crispr