ID: 1058519089

View in Genome Browser
Species Human (GRCh38)
Location 9:105801726-105801748
Sequence GTGTGTACACACTCTGATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058519089_1058519091 -9 Left 1058519089 9:105801726-105801748 CCAGTATCAGAGTGTGTACACAC No data
Right 1058519091 9:105801740-105801762 TGTACACACACTGCGATATTGGG No data
1058519089_1058519092 17 Left 1058519089 9:105801726-105801748 CCAGTATCAGAGTGTGTACACAC No data
Right 1058519092 9:105801766-105801788 AATATCATCCTATTTCCACCTGG No data
1058519089_1058519090 -10 Left 1058519089 9:105801726-105801748 CCAGTATCAGAGTGTGTACACAC No data
Right 1058519090 9:105801739-105801761 GTGTACACACACTGCGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058519089 Original CRISPR GTGTGTACACACTCTGATAC TGG (reversed) Intergenic
No off target data available for this crispr