ID: 1058519091

View in Genome Browser
Species Human (GRCh38)
Location 9:105801740-105801762
Sequence TGTACACACACTGCGATATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058519085_1058519091 15 Left 1058519085 9:105801702-105801724 CCTCTTCCCTTCTGGATATTAGG No data
Right 1058519091 9:105801740-105801762 TGTACACACACTGCGATATTGGG No data
1058519088_1058519091 8 Left 1058519088 9:105801709-105801731 CCTTCTGGATATTAGGACCAGTA No data
Right 1058519091 9:105801740-105801762 TGTACACACACTGCGATATTGGG No data
1058519087_1058519091 9 Left 1058519087 9:105801708-105801730 CCCTTCTGGATATTAGGACCAGT No data
Right 1058519091 9:105801740-105801762 TGTACACACACTGCGATATTGGG No data
1058519089_1058519091 -9 Left 1058519089 9:105801726-105801748 CCAGTATCAGAGTGTGTACACAC No data
Right 1058519091 9:105801740-105801762 TGTACACACACTGCGATATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058519091 Original CRISPR TGTACACACACTGCGATATT GGG Intergenic
No off target data available for this crispr