ID: 1058519338

View in Genome Browser
Species Human (GRCh38)
Location 9:105803293-105803315
Sequence CCTAATATCCAGAGGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058519338_1058519347 18 Left 1058519338 9:105803293-105803315 CCTTCTCCCCTCTGGATATTAGG No data
Right 1058519347 9:105803334-105803356 ATGTACACCTCCTGCAATATTGG No data
1058519338_1058519346 -6 Left 1058519338 9:105803293-105803315 CCTTCTCCCCTCTGGATATTAGG No data
Right 1058519346 9:105803310-105803332 ATTAGGAACAATATCACAGGGGG No data
1058519338_1058519343 -9 Left 1058519338 9:105803293-105803315 CCTTCTCCCCTCTGGATATTAGG No data
Right 1058519343 9:105803307-105803329 GATATTAGGAACAATATCACAGG No data
1058519338_1058519344 -8 Left 1058519338 9:105803293-105803315 CCTTCTCCCCTCTGGATATTAGG No data
Right 1058519344 9:105803308-105803330 ATATTAGGAACAATATCACAGGG No data
1058519338_1058519345 -7 Left 1058519338 9:105803293-105803315 CCTTCTCCCCTCTGGATATTAGG No data
Right 1058519345 9:105803309-105803331 TATTAGGAACAATATCACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058519338 Original CRISPR CCTAATATCCAGAGGGGAGA AGG (reversed) Intergenic
No off target data available for this crispr