ID: 1058520205

View in Genome Browser
Species Human (GRCh38)
Location 9:105808881-105808903
Sequence GTGTACACACCCTGCGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058520205_1058520212 11 Left 1058520205 9:105808881-105808903 CCCATATCGCAGGGTGTGTACAC No data
Right 1058520212 9:105808915-105808937 ATTGTTTGTAATATCCAGGGGGG No data
1058520205_1058520208 7 Left 1058520205 9:105808881-105808903 CCCATATCGCAGGGTGTGTACAC No data
Right 1058520208 9:105808911-105808933 TGACATTGTTTGTAATATCCAGG No data
1058520205_1058520211 10 Left 1058520205 9:105808881-105808903 CCCATATCGCAGGGTGTGTACAC No data
Right 1058520211 9:105808914-105808936 CATTGTTTGTAATATCCAGGGGG No data
1058520205_1058520210 9 Left 1058520205 9:105808881-105808903 CCCATATCGCAGGGTGTGTACAC No data
Right 1058520210 9:105808913-105808935 ACATTGTTTGTAATATCCAGGGG No data
1058520205_1058520209 8 Left 1058520205 9:105808881-105808903 CCCATATCGCAGGGTGTGTACAC No data
Right 1058520209 9:105808912-105808934 GACATTGTTTGTAATATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058520205 Original CRISPR GTGTACACACCCTGCGATAT GGG (reversed) Intergenic
No off target data available for this crispr