ID: 1058526862

View in Genome Browser
Species Human (GRCh38)
Location 9:105867550-105867572
Sequence ATGGCTAAGAGTCTTTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058526858_1058526862 8 Left 1058526858 9:105867519-105867541 CCTGGTGAGGAATAATGGTAATA No data
Right 1058526862 9:105867550-105867572 ATGGCTAAGAGTCTTTCTGTGGG No data
1058526857_1058526862 9 Left 1058526857 9:105867518-105867540 CCCTGGTGAGGAATAATGGTAAT No data
Right 1058526862 9:105867550-105867572 ATGGCTAAGAGTCTTTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058526862 Original CRISPR ATGGCTAAGAGTCTTTCTGT GGG Intergenic
No off target data available for this crispr