ID: 1058528276

View in Genome Browser
Species Human (GRCh38)
Location 9:105881780-105881802
Sequence TCAGTTGGTTGGTTTCTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058528276_1058528281 10 Left 1058528276 9:105881780-105881802 CCCTCAAGAAACCAACCAACTGA No data
Right 1058528281 9:105881813-105881835 CTTTCTGTCTCCCCTAACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058528276 Original CRISPR TCAGTTGGTTGGTTTCTTGA GGG (reversed) Intergenic
No off target data available for this crispr