ID: 1058528281

View in Genome Browser
Species Human (GRCh38)
Location 9:105881813-105881835
Sequence CTTTCTGTCTCCCCTAACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058528279_1058528281 -5 Left 1058528279 9:105881795-105881817 CCAACTGACCTTTTTCAGCTTTC No data
Right 1058528281 9:105881813-105881835 CTTTCTGTCTCCCCTAACAGAGG No data
1058528276_1058528281 10 Left 1058528276 9:105881780-105881802 CCCTCAAGAAACCAACCAACTGA No data
Right 1058528281 9:105881813-105881835 CTTTCTGTCTCCCCTAACAGAGG No data
1058528277_1058528281 9 Left 1058528277 9:105881781-105881803 CCTCAAGAAACCAACCAACTGAC No data
Right 1058528281 9:105881813-105881835 CTTTCTGTCTCCCCTAACAGAGG No data
1058528275_1058528281 11 Left 1058528275 9:105881779-105881801 CCCCTCAAGAAACCAACCAACTG No data
Right 1058528281 9:105881813-105881835 CTTTCTGTCTCCCCTAACAGAGG No data
1058528278_1058528281 -1 Left 1058528278 9:105881791-105881813 CCAACCAACTGACCTTTTTCAGC No data
Right 1058528281 9:105881813-105881835 CTTTCTGTCTCCCCTAACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058528281 Original CRISPR CTTTCTGTCTCCCCTAACAG AGG Intergenic