ID: 1058529205

View in Genome Browser
Species Human (GRCh38)
Location 9:105889236-105889258
Sequence CCATCCCCATGGAGGCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058529193_1058529205 -3 Left 1058529193 9:105889216-105889238 CCCTTGTTCCTGTCCCATCCCCA No data
Right 1058529205 9:105889236-105889258 CCATCCCCATGGAGGCTGGGAGG No data
1058529191_1058529205 13 Left 1058529191 9:105889200-105889222 CCACTCTACAGGTGTCCCCTTGT No data
Right 1058529205 9:105889236-105889258 CCATCCCCATGGAGGCTGGGAGG No data
1058529194_1058529205 -4 Left 1058529194 9:105889217-105889239 CCTTGTTCCTGTCCCATCCCCAT No data
Right 1058529205 9:105889236-105889258 CCATCCCCATGGAGGCTGGGAGG No data
1058529192_1058529205 -2 Left 1058529192 9:105889215-105889237 CCCCTTGTTCCTGTCCCATCCCC No data
Right 1058529205 9:105889236-105889258 CCATCCCCATGGAGGCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058529205 Original CRISPR CCATCCCCATGGAGGCTGGG AGG Intergenic
No off target data available for this crispr