ID: 1058530623

View in Genome Browser
Species Human (GRCh38)
Location 9:105901901-105901923
Sequence CTAAGGTCCTGAAAGTGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058530618_1058530623 8 Left 1058530618 9:105901870-105901892 CCTGGGCTTAAGGAAGGCAATTC No data
Right 1058530623 9:105901901-105901923 CTAAGGTCCTGAAAGTGTCAGGG No data
1058530615_1058530623 20 Left 1058530615 9:105901858-105901880 CCAGGGGGCAATCCTGGGCTTAA No data
Right 1058530623 9:105901901-105901923 CTAAGGTCCTGAAAGTGTCAGGG No data
1058530612_1058530623 27 Left 1058530612 9:105901851-105901873 CCAGTAGCCAGGGGGCAATCCTG No data
Right 1058530623 9:105901901-105901923 CTAAGGTCCTGAAAGTGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058530623 Original CRISPR CTAAGGTCCTGAAAGTGTCA GGG Intergenic
No off target data available for this crispr