ID: 1058539210

View in Genome Browser
Species Human (GRCh38)
Location 9:105994418-105994440
Sequence AAGGATGTTCAACTTGATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058539199_1058539210 21 Left 1058539199 9:105994374-105994396 CCTTGGCTAACTTAAATGCTCCT No data
Right 1058539210 9:105994418-105994440 AAGGATGTTCAACTTGATACTGG No data
1058539200_1058539210 1 Left 1058539200 9:105994394-105994416 CCTCCCCGCCACCCCTCCGAAAA No data
Right 1058539210 9:105994418-105994440 AAGGATGTTCAACTTGATACTGG No data
1058539201_1058539210 -2 Left 1058539201 9:105994397-105994419 CCCCGCCACCCCTCCGAAAAAAA No data
Right 1058539210 9:105994418-105994440 AAGGATGTTCAACTTGATACTGG No data
1058539206_1058539210 -10 Left 1058539206 9:105994405-105994427 CCCCTCCGAAAAAAAGGATGTTC No data
Right 1058539210 9:105994418-105994440 AAGGATGTTCAACTTGATACTGG No data
1058539203_1058539210 -4 Left 1058539203 9:105994399-105994421 CCGCCACCCCTCCGAAAAAAAGG No data
Right 1058539210 9:105994418-105994440 AAGGATGTTCAACTTGATACTGG No data
1058539205_1058539210 -7 Left 1058539205 9:105994402-105994424 CCACCCCTCCGAAAAAAAGGATG No data
Right 1058539210 9:105994418-105994440 AAGGATGTTCAACTTGATACTGG No data
1058539202_1058539210 -3 Left 1058539202 9:105994398-105994420 CCCGCCACCCCTCCGAAAAAAAG No data
Right 1058539210 9:105994418-105994440 AAGGATGTTCAACTTGATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058539210 Original CRISPR AAGGATGTTCAACTTGATAC TGG Intergenic
No off target data available for this crispr