ID: 1058539309

View in Genome Browser
Species Human (GRCh38)
Location 9:105995110-105995132
Sequence TGGTCTTGTTCACATGACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058539309_1058539310 -6 Left 1058539309 9:105995110-105995132 CCACTGTCATGTGAACAAGACCA No data
Right 1058539310 9:105995127-105995149 AGACCAAACCAGCTTTCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058539309 Original CRISPR TGGTCTTGTTCACATGACAG TGG (reversed) Intergenic