ID: 1058541424

View in Genome Browser
Species Human (GRCh38)
Location 9:106016257-106016279
Sequence GAAATTGAACTGATAAATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058541424_1058541426 22 Left 1058541424 9:106016257-106016279 CCTTGATTTATCAGTTCAATTTC No data
Right 1058541426 9:106016302-106016324 GAGGCACTTTACAATATGTAAGG No data
1058541424_1058541425 3 Left 1058541424 9:106016257-106016279 CCTTGATTTATCAGTTCAATTTC No data
Right 1058541425 9:106016283-106016305 TGTTCTGTATGAAGACTGAGAGG No data
1058541424_1058541428 27 Left 1058541424 9:106016257-106016279 CCTTGATTTATCAGTTCAATTTC No data
Right 1058541428 9:106016307-106016329 ACTTTACAATATGTAAGGGAAGG No data
1058541424_1058541427 23 Left 1058541424 9:106016257-106016279 CCTTGATTTATCAGTTCAATTTC No data
Right 1058541427 9:106016303-106016325 AGGCACTTTACAATATGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058541424 Original CRISPR GAAATTGAACTGATAAATCA AGG (reversed) Intergenic
No off target data available for this crispr