ID: 1058541426

View in Genome Browser
Species Human (GRCh38)
Location 9:106016302-106016324
Sequence GAGGCACTTTACAATATGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058541424_1058541426 22 Left 1058541424 9:106016257-106016279 CCTTGATTTATCAGTTCAATTTC No data
Right 1058541426 9:106016302-106016324 GAGGCACTTTACAATATGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058541426 Original CRISPR GAGGCACTTTACAATATGTA AGG Intergenic
No off target data available for this crispr