ID: 1058544169

View in Genome Browser
Species Human (GRCh38)
Location 9:106042782-106042804
Sequence TTATATCTGCAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058544164_1058544169 18 Left 1058544164 9:106042741-106042763 CCCAGTAATAGGCCAAGAGCTGT 0: 16
1: 194
2: 203
3: 147
4: 222
Right 1058544169 9:106042782-106042804 TTATATCTGCAGAAGATGGCAGG No data
1058544167_1058544169 6 Left 1058544167 9:106042753-106042775 CCAAGAGCTGTCTCTCAAAAGGA 0: 181
1: 197
2: 163
3: 130
4: 293
Right 1058544169 9:106042782-106042804 TTATATCTGCAGAAGATGGCAGG No data
1058544165_1058544169 17 Left 1058544165 9:106042742-106042764 CCAGTAATAGGCCAAGAGCTGTC 0: 17
1: 183
2: 194
3: 123
4: 177
Right 1058544169 9:106042782-106042804 TTATATCTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058544169 Original CRISPR TTATATCTGCAGAAGATGGC AGG Intergenic
No off target data available for this crispr