ID: 1058544907

View in Genome Browser
Species Human (GRCh38)
Location 9:106050916-106050938
Sequence ATCCCAGGAAATTCCAATAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058544907_1058544912 19 Left 1058544907 9:106050916-106050938 CCCCTATTGGAATTTCCTGGGAT No data
Right 1058544912 9:106050958-106050980 TACATTCCCATCTTTGTCTTCGG No data
1058544907_1058544913 20 Left 1058544907 9:106050916-106050938 CCCCTATTGGAATTTCCTGGGAT No data
Right 1058544913 9:106050959-106050981 ACATTCCCATCTTTGTCTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058544907 Original CRISPR ATCCCAGGAAATTCCAATAG GGG (reversed) Intergenic
No off target data available for this crispr