ID: 1058544909

View in Genome Browser
Species Human (GRCh38)
Location 9:106050918-106050940
Sequence CAATCCCAGGAAATTCCAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058544909_1058544913 18 Left 1058544909 9:106050918-106050940 CCTATTGGAATTTCCTGGGATTG No data
Right 1058544913 9:106050959-106050981 ACATTCCCATCTTTGTCTTCGGG No data
1058544909_1058544917 30 Left 1058544909 9:106050918-106050940 CCTATTGGAATTTCCTGGGATTG No data
Right 1058544917 9:106050971-106050993 TTGTCTTCGGGTCTGCTTCTGGG No data
1058544909_1058544916 29 Left 1058544909 9:106050918-106050940 CCTATTGGAATTTCCTGGGATTG No data
Right 1058544916 9:106050970-106050992 TTTGTCTTCGGGTCTGCTTCTGG No data
1058544909_1058544912 17 Left 1058544909 9:106050918-106050940 CCTATTGGAATTTCCTGGGATTG No data
Right 1058544912 9:106050958-106050980 TACATTCCCATCTTTGTCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058544909 Original CRISPR CAATCCCAGGAAATTCCAAT AGG (reversed) Intergenic
No off target data available for this crispr